Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Slamf6'

583484

Institutional Source

Beutler Lab

Gene Symbol

Slamf6

Ensembl Gene

ENSMUSG00000015314

Gene Name

SLAM family member 6

Synonyms

Ly108, SF2000, KAL1, KAL1b, NTB-A

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_030710.2; MGI:1353620

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

171917515-171953170 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 171919758 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 29 (L29Q)

Ref Sequence

ENSEMBL: ENSMUSP00000142242 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171330] [ENSMUST00000194182] [ENSMUST00000194561] [ENSMUST00000195656]

AlphaFold

Q9ET39

Predicted Effect

probably benign
Transcript: ENSMUST00000171330

SMART Domains

Protein: ENSMUSP00000130610
Gene: ENSMUSG00000015314

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	28	37	N/A	INTRINSIC
IG	39	142	1.49e-2	SMART
low complexity region	145	161	N/A	INTRINSIC
Blast:IG_like	162	226	7e-16	BLAST
transmembrane domain	240	262	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000194182
AA Change: L29Q

SMART Domains

Protein: ENSMUSP00000142242
Gene: ENSMUSG00000015314
AA Change: L29Q

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194561

SMART Domains

Protein: ENSMUSP00000141944
Gene: ENSMUSG00000015314

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	28	37	N/A	INTRINSIC
IG	39	142	1.49e-2	SMART
low complexity region	145	161	N/A	INTRINSIC
Blast:IG_like	162	226	5e-16	BLAST
transmembrane domain	240	262	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195656

SMART Domains

Protein: ENSMUSP00000141448
Gene: ENSMUSG00000015314

Domain	Start	End	E-Value	Type
low complexity region	28	37	N/A	INTRINSIC
IG	39	142	5.9e-5	SMART
low complexity region	145	161	N/A	INTRINSIC
Blast:IG_like	162	226	8e-16	BLAST
transmembrane domain	240	262	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

Strain: 3581614
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein, belonging to the CD2 subfamily of the immunoglobulin superfamily. This encoded protein is expressed on Natural killer (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It functions as a coreceptor in the process of NK cell activation. It can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one null allele show no overt phenotype. Mice homozygous for another null allele show impaired IL-4 production by CD4+ T cells, reduced inflammatory response to L. mexicana infection, high susceptibility to S. typhimurium infection, and defective neutrophil bactericidal activity. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Slamf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Slamf6	APN	1	171917780	missense	probably null	0.27
IGL01011:Slamf6	APN	1	171938099	missense	probably benign	0.19
P0016:Slamf6	UTSW	1	171936501	missense	probably damaging	0.97
R1565:Slamf6	UTSW	1	171934408	missense	possibly damaging	0.53
R1763:Slamf6	UTSW	1	171942587	intron	probably benign
R1774:Slamf6	UTSW	1	171942587	intron	probably benign
R1993:Slamf6	UTSW	1	171934209	missense	possibly damaging	0.74
R2155:Slamf6	UTSW	1	171938008	missense	probably damaging	0.99
R2328:Slamf6	UTSW	1	171934251	missense	probably benign	0.00
R4693:Slamf6	UTSW	1	171934113	nonsense	probably null
R5062:Slamf6	UTSW	1	171936533	missense	possibly damaging	0.93
R5172:Slamf6	UTSW	1	171936580	missense	probably benign	0.01
R5249:Slamf6	UTSW	1	171936682	missense	probably damaging	1.00
R5328:Slamf6	UTSW	1	171938095	missense	probably benign	0.04
R5771:Slamf6	UTSW	1	171917774	missense	probably damaging	0.98
R6339:Slamf6	UTSW	1	171948048	missense	probably null	1.00
R6960:Slamf6	UTSW	1	171917753	missense	probably damaging	0.98
R7176:Slamf6	UTSW	1	171934291	missense	probably benign	0.13
R7400:Slamf6	UTSW	1	171919793	missense	unknown
R7629:Slamf6	UTSW	1	171936624	missense	probably damaging	0.97
R8202:Slamf6	UTSW	1	171934219	missense	probably benign	0.01
R8934:Slamf6	UTSW	1	171917771	missense	possibly damaging	0.76
R9225:Slamf6	UTSW	1	171936703	missense	probably benign	0.25
R9338:Slamf6	UTSW	1	171919590	intron	probably benign
R9581:Slamf6	UTSW	1	171934330	missense
RF025:Slamf6	UTSW	1	171941582	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGAGAACCTCTCTGGACTG -3'
(R):5'- TTGCCTCCAAGGGAATGAG -3'

Sequencing Primer
(F):5'- ACTGGGTGTTGAGGAAGAACTTTC -3'
(R):5'- AGCTTCAAGTTCACTGAGAGTCCG -3'

Posted On

2019-10-17