Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Akt3'

583485

Institutional Source

Beutler Lab

Gene Symbol

Akt3

Ensembl Gene

ENSMUSG00000019699

Gene Name

thymoma viral proto-oncogene 3

Synonyms

D930002M15Rik, Nmf350, PKB gamma

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.606) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

177020073-177258203 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 177097034 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 165 (V165D)

Ref Sequence

ENSEMBL: ENSMUSP00000106790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019843] [ENSMUST00000111159] [ENSMUST00000111160]

AlphaFold

Q9WUA6

Predicted Effect

probably damaging
Transcript: ENSMUST00000019843
AA Change: V165D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000019843
Gene: ENSMUSG00000019699
AA Change: V165D

Domain	Start	End	E-Value	Type
PH	6	109	4.81e-16	SMART
S_TKc	148	405	3.53e-106	SMART
S_TK_X	406	467	6.37e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111159
AA Change: V165D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106789
Gene: ENSMUSG00000019699
AA Change: V165D

Domain	Start	End	E-Value	Type
PH	6	109	4.81e-16	SMART
S_TKc	148	405	3.53e-106	SMART
S_TK_X	406	475	2.61e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111160
AA Change: V165D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106790
Gene: ENSMUSG00000019699
AA Change: V165D

Domain	Start	End	E-Value	Type
PH	6	109	4.81e-16	SMART
S_TKc	148	405	3.53e-106	SMART
S_TK_X	406	475	2.61e-17	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a 20% decrease in brain size and have smaller and fewer cells in the brain. Mice heterozygous for an ENU-induced mutation exhibit increased seizures (sporadic and induced) and increased brain weight and size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Akt3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Akt3	APN	1	177130967	splice site	probably benign
IGL02348:Akt3	APN	1	177059386	missense	probably damaging	0.99
IGL02394:Akt3	APN	1	177059419	missense	probably damaging	1.00
IGL03005:Akt3	APN	1	177067227	missense	probably damaging	1.00
R0114:Akt3	UTSW	1	177067251	missense	probably damaging	1.00
R1403:Akt3	UTSW	1	177131110	splice site	probably benign
R1452:Akt3	UTSW	1	177131067	missense	possibly damaging	0.93
R1495:Akt3	UTSW	1	177103042	missense	probably benign
R1961:Akt3	UTSW	1	177096995	missense	probably damaging	0.97
R2062:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R2064:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R2066:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R2068:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R4155:Akt3	UTSW	1	177096977	missense	possibly damaging	0.92
R4937:Akt3	UTSW	1	177050127	missense	possibly damaging	0.89
R5097:Akt3	UTSW	1	177248688	missense	probably benign	0.01
R5414:Akt3	UTSW	1	177050251	missense	probably damaging	0.98
R6336:Akt3	UTSW	1	177031712	missense	probably damaging	1.00
R6723:Akt3	UTSW	1	177050190	nonsense	probably null
R6752:Akt3	UTSW	1	177050190	nonsense	probably null
R6753:Akt3	UTSW	1	177050190	nonsense	probably null
R6755:Akt3	UTSW	1	177050190	nonsense	probably null
R6765:Akt3	UTSW	1	177050190	nonsense	probably null
R6766:Akt3	UTSW	1	177050190	nonsense	probably null
R6767:Akt3	UTSW	1	177050190	nonsense	probably null
R6782:Akt3	UTSW	1	177050190	nonsense	probably null
R6787:Akt3	UTSW	1	177050190	nonsense	probably null
R6847:Akt3	UTSW	1	177031659	missense	probably damaging	1.00
R7525:Akt3	UTSW	1	177020107	nonsense	probably null
R8000:Akt3	UTSW	1	177050197	missense	probably damaging	1.00
R8326:Akt3	UTSW	1	177050045	missense	possibly damaging	0.95
R8947:Akt3	UTSW	1	177131079	missense	probably damaging	1.00
R9047:Akt3	UTSW	1	177059389	missense	probably damaging	0.98
R9474:Akt3	UTSW	1	177025386	missense	probably damaging	1.00
R9564:Akt3	UTSW	1	177080203	missense	possibly damaging	0.47
R9680:Akt3	UTSW	1	177131073	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTCACAAGAGAATAACAGTTTCACC -3'
(R):5'- AGGTAGCACCACTTAAAGCAAG -3'

Sequencing Primer
(F):5'- TGCAGGTTCACACTACAG -3'
(R):5'- TTGGTATCCCAGATTGCTGAAGAGAC -3'

Posted On

2019-10-17