Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Vps39'

583489

Institutional Source

Beutler Lab

Gene Symbol

Vps39

Ensembl Gene

ENSMUSG00000027291

Gene Name

VPS39 HOPS complex subunit

Synonyms

mVam6, Vam6P, Vam6, A230065P22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120316461-120353137 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 120324695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 550 (N550I)

Ref Sequence

ENSEMBL: ENSMUSP00000099559 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028752] [ENSMUST00000102501]

AlphaFold

Q8R5L3

Predicted Effect

probably damaging
Transcript: ENSMUST00000028752
AA Change: N539I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028752
Gene: ENSMUSG00000027291
AA Change: N539I

Domain	Start	End	E-Value	Type
Pfam:CNH	19	280	8.3e-53	PFAM
Pfam:Clathrin	410	536	3.9e-9	PFAM
Pfam:Vps39_1	449	551	1.7e-35	PFAM
Pfam:Clathrin	570	740	2.3e-8	PFAM
Pfam:Vps39_2	761	869	5.1e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102501
AA Change: N550I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099559
Gene: ENSMUSG00000027291
AA Change: N550I

Domain	Start	End	E-Value	Type
Pfam:CNH	20	291	1.3e-32	PFAM
Pfam:Clathrin	421	547	2e-9	PFAM
Pfam:Vps39_1	460	562	6.7e-36	PFAM
Pfam:Clathrin	582	751	2.3e-8	PFAM
Pfam:Vps39_2	772	880	6.6e-36	PFAM

Meta Mutation Damage Score

0.7026

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Vps39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01393:Vps39	APN	2	120350238	splice site	probably benign
IGL01629:Vps39	APN	2	120323598	missense	probably benign	0.11
IGL01812:Vps39	APN	2	120320790	splice site	probably benign
IGL01936:Vps39	APN	2	120323128	missense	probably benign	0.23
IGL02379:Vps39	APN	2	120323608	missense	probably benign	0.17
IGL02892:Vps39	APN	2	120323171	splice site	probably benign
IGL02943:Vps39	APN	2	120339487	missense	possibly damaging	0.77
Jigsaw	UTSW	2	120333416	missense	probably damaging	0.98
matryoshka	UTSW	2	120324695	missense	probably damaging	1.00
R0001:Vps39	UTSW	2	120318053	missense	probably benign	0.09
R0329:Vps39	UTSW	2	120338787	missense	possibly damaging	0.89
R0330:Vps39	UTSW	2	120338787	missense	possibly damaging	0.89
R0364:Vps39	UTSW	2	120345638	missense	probably damaging	1.00
R1483:Vps39	UTSW	2	120323648	missense	probably damaging	1.00
R1625:Vps39	UTSW	2	120323625	missense	probably damaging	1.00
R1837:Vps39	UTSW	2	120325397	missense	probably damaging	1.00
R1839:Vps39	UTSW	2	120325397	missense	probably damaging	1.00
R1934:Vps39	UTSW	2	120318077	missense	probably damaging	1.00
R2018:Vps39	UTSW	2	120343227	missense	probably damaging	1.00
R2019:Vps39	UTSW	2	120343227	missense	probably damaging	1.00
R2178:Vps39	UTSW	2	120323679	nonsense	probably null
R2513:Vps39	UTSW	2	120338787	missense	probably damaging	1.00
R3771:Vps39	UTSW	2	120342016	missense	possibly damaging	0.85
R3952:Vps39	UTSW	2	120350175	missense	probably benign	0.15
R4580:Vps39	UTSW	2	120339333	missense	probably benign	0.35
R4815:Vps39	UTSW	2	120338559	missense	probably benign	0.37
R4851:Vps39	UTSW	2	120321831	intron	probably benign
R4894:Vps39	UTSW	2	120352959	missense	probably damaging	1.00
R5447:Vps39	UTSW	2	120352932	missense	probably benign	0.43
R5483:Vps39	UTSW	2	120323083	missense	probably benign	0.08
R5715:Vps39	UTSW	2	120325236	missense	possibly damaging	0.73
R5886:Vps39	UTSW	2	120321572	intron	probably benign
R5949:Vps39	UTSW	2	120328668	missense	probably benign	0.23
R5954:Vps39	UTSW	2	120324662	missense	probably damaging	1.00
R5973:Vps39	UTSW	2	120328705	missense	probably damaging	0.99
R6004:Vps39	UTSW	2	120345650	missense	possibly damaging	0.89
R6208:Vps39	UTSW	2	120333416	missense	probably damaging	0.98
R6705:Vps39	UTSW	2	120320676	missense	probably benign	0.00
R6915:Vps39	UTSW	2	120321031	nonsense	probably null
R7780:Vps39	UTSW	2	120325199	nonsense	probably null
R7869:Vps39	UTSW	2	120339394	missense	possibly damaging	0.89
R8061:Vps39	UTSW	2	120344211	missense	probably benign	0.00
R8770:Vps39	UTSW	2	120323067	missense	probably benign
R8787:Vps39	UTSW	2	120342025	missense	probably damaging	1.00
R8933:Vps39	UTSW	2	120338585	missense	probably benign	0.00
R8962:Vps39	UTSW	2	120344206	nonsense	probably null
R9302:Vps39	UTSW	2	120321044	splice site	probably benign
R9573:Vps39	UTSW	2	120324698	missense	possibly damaging	0.89
R9610:Vps39	UTSW	2	120342004	missense	probably damaging	0.99
R9611:Vps39	UTSW	2	120342004	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGTGACTCCAGAGGAATGG -3'
(R):5'- GACCCTCCATGGTTGAACAG -3'

Sequencing Primer
(F):5'- CTGTGACTCCAGAGGAATGGTATAG -3'
(R):5'- CCTCCATGGTTGAACAGTGAAATC -3'

Posted On

2019-10-17