Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Cenpe'

583493

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

045607-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135243762 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 103 (S103G)

Ref Sequence

ENSEMBL: ENSMUSP00000143435 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062893
AA Change: S1331G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: S1331G

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000197369
AA Change: S103G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328
AA Change: S103G

Domain	Start	End	E-Value	Type
coiled coil region	2	49	N/A	INTRINSIC
coiled coil region	85	172	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CAAGGTTCCAGAGCAAGAGC -3'
(R):5'- GTGAGATTTTAACTGTGACACAAGC -3'

Sequencing Primer
(F):5'- CAAGAGCTGCTTCCTGTTGTCAAAG -3'
(R):5'- TTAATCCCAGCGCTTGAGAG -3'

Posted On

2019-10-17