Incidental Mutation 'R7535:Zfp292'
ID 583495
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Name zinc finger protein 292
Synonyms Zfp-15, 9430062L07Rik, Zn-16, Zfp15, Zn-15, 5730450D02Rik, Krox-10
MMRRC Submission 045607-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.861) question?
Stock # R7535 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 34803113-34882960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34811487 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 524 (D524G)
Ref Sequence ENSEMBL: ENSMUSP00000037233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
AlphaFold Q9Z2U2
Predicted Effect probably benign
Transcript: ENSMUST00000047950
AA Change: D524G

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: D524G

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098163
AA Change: D519G

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: D519G

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,837,463 (GRCm39) L449Q probably benign Het
Agtpbp1 T C 13: 59,652,067 (GRCm39) T415A probably benign Het
Akt3 A T 1: 176,924,600 (GRCm39) V165D probably damaging Het
Cbr2 T A 11: 120,620,628 (GRCm39) I219F probably damaging Het
Cdh20 T A 1: 104,902,768 (GRCm39) D486E probably damaging Het
Cenpe A G 3: 134,949,523 (GRCm39) S103G possibly damaging Het
Chd4 T A 6: 125,105,836 (GRCm39) S1818T probably benign Het
Chst5 T C 8: 112,616,795 (GRCm39) D275G probably damaging Het
Clca3a1 A G 3: 144,724,328 (GRCm39) I244T probably damaging Het
Cyp2c54 A G 19: 40,058,716 (GRCm39) Y239H probably benign Het
Czib T G 4: 107,752,097 (GRCm39) S159A probably benign Het
Ddx25 A G 9: 35,454,951 (GRCm39) F446L possibly damaging Het
Dgkb T C 12: 38,186,646 (GRCm39) L265P probably damaging Het
Dis3 A G 14: 99,327,415 (GRCm39) S363P probably benign Het
Disp3 T C 4: 148,327,323 (GRCm39) E1187G probably damaging Het
Dop1b G A 16: 93,603,249 (GRCm39) G2061R probably damaging Het
Dsp T C 13: 38,376,765 (GRCm39) S1517P probably benign Het
Epg5 T A 18: 78,076,141 (GRCm39) V2513E probably benign Het
Fryl T A 5: 73,255,539 (GRCm39) T831S probably benign Het
Gm6309 A T 5: 146,105,100 (GRCm39) V271D probably damaging Het
H2-M2 G T 17: 37,793,528 (GRCm39) S159R probably benign Het
Helq A G 5: 100,937,999 (GRCm39) probably null Het
Herc1 G C 9: 66,382,135 (GRCm39) D3621H probably damaging Het
Hsd11b2 A T 8: 106,245,755 (GRCm39) I87F probably damaging Het
Ice2 A G 9: 69,339,360 (GRCm39) N959S probably damaging Het
Ifi47 T A 11: 48,987,452 (GRCm39) D406E probably damaging Het
Ifit3 T G 19: 34,565,280 (GRCm39) S275R probably damaging Het
Insl5 C A 4: 102,875,395 (GRCm39) K118N probably damaging Het
Irf7 A T 7: 140,844,550 (GRCm39) F158I probably benign Het
Kat2b T C 17: 53,931,431 (GRCm39) L143P probably damaging Het
Klk1b1 A T 7: 43,619,746 (GRCm39) N102Y probably damaging Het
Krt13 C T 11: 100,008,824 (GRCm39) G410S unknown Het
Larp6 A T 9: 60,631,437 (GRCm39) T70S probably benign Het
Lrrc37a T C 11: 103,392,683 (GRCm39) E914G possibly damaging Het
Mindy4 T C 6: 55,274,738 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myom2 A G 8: 15,167,679 (GRCm39) Y1088C probably damaging Het
Mysm1 T C 4: 94,840,452 (GRCm39) N655D probably benign Het
Nbas T A 12: 13,329,390 (GRCm39) S112T probably damaging Het
Neb A G 2: 52,055,115 (GRCm39) probably null Het
Noxred1 G A 12: 87,280,206 (GRCm39) A42V probably benign Het
Olfm5 G A 7: 103,803,444 (GRCm39) P340S possibly damaging Het
Or11h4 G A 14: 50,974,122 (GRCm39) P166S probably benign Het
Or2l5 T C 16: 19,333,544 (GRCm39) T281A probably damaging Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Or5m8 T A 2: 85,822,245 (GRCm39) V28E probably benign Het
Or9i1b A G 19: 13,896,449 (GRCm39) K22E probably benign Het
Pccb A T 9: 100,876,615 (GRCm39) probably null Het
Pnn T A 12: 59,118,923 (GRCm39) V502E probably benign Het
Pole2 A T 12: 69,269,203 (GRCm39) I98K probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rasgrp4 A G 7: 28,838,484 (GRCm39) K111E probably benign Het
Rbbp6 G A 7: 122,589,366 (GRCm39) M351I probably benign Het
Rgs19 T G 2: 181,333,101 (GRCm39) H53P probably damaging Het
Rin1 A T 19: 5,102,564 (GRCm39) T369S probably benign Het
Rnaset2b G A 17: 7,259,138 (GRCm39) E135K possibly damaging Het
Rprd2 G A 3: 95,683,899 (GRCm39) P379S probably damaging Het
Sbno1 A G 5: 124,551,342 (GRCm39) L47P possibly damaging Het
Slamf6 T A 1: 171,747,325 (GRCm39) L29Q unknown Het
Slc16a14 T C 1: 84,890,843 (GRCm39) Y154C probably damaging Het
Slc22a29 A G 19: 8,147,342 (GRCm39) F340S probably damaging Het
Slc6a4 T G 11: 76,905,976 (GRCm39) I259S possibly damaging Het
Smarca4 G A 9: 21,558,921 (GRCm39) V651I possibly damaging Het
Susd5 C T 9: 113,893,108 (GRCm39) A62V possibly damaging Het
Syt1 T A 10: 108,463,283 (GRCm39) probably null Het
Taf10 T C 7: 105,390,117 (GRCm39) I218T probably benign Het
Tas1r1 C A 4: 152,112,819 (GRCm39) V745F probably benign Het
Tas2r125 C A 6: 132,887,287 (GRCm39) T225K probably damaging Het
Tcp11l2 G T 10: 84,430,523 (GRCm39) R216L possibly damaging Het
Tnks1bp1 C T 2: 84,893,624 (GRCm39) Q1184* probably null Het
Treml2 T A 17: 48,609,847 (GRCm39) V93D probably damaging Het
Trim11 G A 11: 58,872,891 (GRCm39) E192K probably damaging Het
Trim43a A G 9: 88,470,201 (GRCm39) K336E probably damaging Het
Tspan33 T A 6: 29,717,588 (GRCm39) I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 (GRCm39) C458Y probably damaging Het
Ttc6 A G 12: 57,623,305 (GRCm39) S235G probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Usp36 A T 11: 118,152,872 (GRCm39) S1084T possibly damaging Het
Vps39 T A 2: 120,155,176 (GRCm39) N550I probably damaging Het
Wdr47 A G 3: 108,537,027 (GRCm39) I572V probably benign Het
Zfp112 A T 7: 23,826,135 (GRCm39) Y705F probably damaging Het
Zfp282 A G 6: 47,881,878 (GRCm39) T522A probably benign Het
Zfp90 A T 8: 107,150,900 (GRCm39) K204N possibly damaging Het
Zmym2 T C 14: 57,194,536 (GRCm39) S1265P probably damaging Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34,808,683 (GRCm39) missense probably benign 0.15
IGL00502:Zfp292 APN 4 34,809,775 (GRCm39) missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34,808,790 (GRCm39) missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34,807,827 (GRCm39) missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34,806,763 (GRCm39) missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34,807,961 (GRCm39) missense probably benign 0.01
IGL01639:Zfp292 APN 4 34,809,048 (GRCm39) missense probably benign 0.04
IGL01688:Zfp292 APN 4 34,807,855 (GRCm39) missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34,809,244 (GRCm39) missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34,808,810 (GRCm39) missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34,805,416 (GRCm39) missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34,806,462 (GRCm39) missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34,809,415 (GRCm39) missense probably benign 0.14
IGL02715:Zfp292 APN 4 34,819,542 (GRCm39) missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34,806,163 (GRCm39) missense probably benign 0.00
F5770:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34,807,524 (GRCm39) missense probably benign 0.00
R0153:Zfp292 UTSW 4 34,811,185 (GRCm39) missense probably benign 0.26
R0184:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34,806,281 (GRCm39) missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34,808,227 (GRCm39) missense probably benign 0.25
R0433:Zfp292 UTSW 4 34,839,959 (GRCm39) missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34,810,059 (GRCm39) missense probably benign 0.28
R0555:Zfp292 UTSW 4 34,807,194 (GRCm39) missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34,807,399 (GRCm39) missense probably benign 0.02
R0748:Zfp292 UTSW 4 34,816,424 (GRCm39) splice site probably benign
R0782:Zfp292 UTSW 4 34,839,382 (GRCm39) missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34,809,114 (GRCm39) missense probably benign 0.00
R0879:Zfp292 UTSW 4 34,811,218 (GRCm39) missense probably benign 0.00
R1083:Zfp292 UTSW 4 34,807,569 (GRCm39) missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34,805,238 (GRCm39) missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34,805,397 (GRCm39) missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34,808,935 (GRCm39) missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34,811,237 (GRCm39) missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34,811,043 (GRCm39) missense probably benign 0.02
R1837:Zfp292 UTSW 4 34,810,264 (GRCm39) missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34,805,100 (GRCm39) missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34,807,452 (GRCm39) missense probably benign 0.22
R2107:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34,810,266 (GRCm39) missense probably benign 0.13
R2182:Zfp292 UTSW 4 34,807,417 (GRCm39) missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34,807,962 (GRCm39) missense probably benign 0.07
R2306:Zfp292 UTSW 4 34,809,468 (GRCm39) missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34,811,281 (GRCm39) missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34,806,426 (GRCm39) missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34,808,595 (GRCm39) missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34,808,814 (GRCm39) missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34,810,326 (GRCm39) missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34,807,744 (GRCm39) missense probably benign 0.00
R4006:Zfp292 UTSW 4 34,809,611 (GRCm39) missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34,810,863 (GRCm39) missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34,806,079 (GRCm39) missense probably benign 0.04
R4641:Zfp292 UTSW 4 34,807,828 (GRCm39) missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34,807,078 (GRCm39) missense probably benign 0.00
R4718:Zfp292 UTSW 4 34,819,521 (GRCm39) missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34,808,917 (GRCm39) missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34,839,878 (GRCm39) missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34,809,755 (GRCm39) missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34,805,842 (GRCm39) missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34,807,491 (GRCm39) missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34,806,261 (GRCm39) missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34,811,703 (GRCm39) missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34,806,747 (GRCm39) missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34,805,125 (GRCm39) missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34,805,464 (GRCm39) missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34,819,549 (GRCm39) missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34,811,902 (GRCm39) missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34,808,497 (GRCm39) missense probably benign 0.13
R6209:Zfp292 UTSW 4 34,809,442 (GRCm39) missense probably benign 0.14
R6275:Zfp292 UTSW 4 34,808,883 (GRCm39) missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34,816,301 (GRCm39) missense probably benign 0.21
R6747:Zfp292 UTSW 4 34,806,894 (GRCm39) missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34,808,593 (GRCm39) missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34,807,812 (GRCm39) missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34,816,357 (GRCm39) missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34,809,784 (GRCm39) missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34,806,796 (GRCm39) missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34,808,679 (GRCm39) missense probably benign
R7254:Zfp292 UTSW 4 34,819,476 (GRCm39) missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34,806,839 (GRCm39) missense probably benign
R7378:Zfp292 UTSW 4 34,808,384 (GRCm39) missense probably benign 0.26
R7589:Zfp292 UTSW 4 34,806,777 (GRCm39) missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34,809,865 (GRCm39) missense probably benign 0.02
R7979:Zfp292 UTSW 4 34,809,198 (GRCm39) missense probably benign 0.02
R7997:Zfp292 UTSW 4 34,808,688 (GRCm39) missense probably damaging 0.96
R8129:Zfp292 UTSW 4 34,807,386 (GRCm39) missense probably damaging 1.00
R8211:Zfp292 UTSW 4 34,806,163 (GRCm39) missense probably benign 0.00
R8302:Zfp292 UTSW 4 34,810,893 (GRCm39) missense possibly damaging 0.64
R8500:Zfp292 UTSW 4 34,826,691 (GRCm39) critical splice donor site probably null
R8709:Zfp292 UTSW 4 34,805,982 (GRCm39) missense probably damaging 1.00
R8947:Zfp292 UTSW 4 34,811,835 (GRCm39) missense probably damaging 1.00
R9099:Zfp292 UTSW 4 34,809,228 (GRCm39) missense possibly damaging 0.53
R9190:Zfp292 UTSW 4 34,819,563 (GRCm39) missense probably damaging 1.00
R9256:Zfp292 UTSW 4 34,839,899 (GRCm39) missense probably benign 0.02
R9371:Zfp292 UTSW 4 34,810,800 (GRCm39) missense probably damaging 1.00
R9492:Zfp292 UTSW 4 34,810,794 (GRCm39) missense probably benign 0.12
R9574:Zfp292 UTSW 4 34,839,460 (GRCm39) missense probably damaging 1.00
V7580:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34,806,783 (GRCm39) missense possibly damaging 0.85
Z1177:Zfp292 UTSW 4 34,811,058 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGACTGTTTAACATGCAGGG -3'
(R):5'- GAAGAGGCGTCTATTGTGTCC -3'

Sequencing Primer
(F):5'- CATGAGGGACAAACGAGTCTTTAG -3'
(R):5'- CCTCAATTGATGAACTGAATGACAG -3'
Posted On 2019-10-17