Incidental Mutation 'R7535:Zfp292'
ID583495
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Namezinc finger protein 292
SynonymsZn-16, 5730450D02Rik, Zfp15, Zn-15, Zfp-15, 9430062L07Rik, Krox-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location34803113-34882960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34811487 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 524 (D524G)
Ref Sequence ENSEMBL: ENSMUSP00000037233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
Predicted Effect probably benign
Transcript: ENSMUST00000047950
AA Change: D524G

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: D524G

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098163
AA Change: D519G

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: D519G

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34808683 missense probably benign 0.15
IGL00502:Zfp292 APN 4 34809775 missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34808790 missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34807827 missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34806763 missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34807961 missense probably benign 0.01
IGL01639:Zfp292 APN 4 34809048 missense probably benign 0.04
IGL01688:Zfp292 APN 4 34807855 missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34809244 missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34808810 missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34805416 missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34806462 missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34809415 missense probably benign 0.14
IGL02715:Zfp292 APN 4 34819542 missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34806163 missense probably benign 0.00
F5770:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
PIT4362001:Zfp292 UTSW 4 34807524 missense probably benign 0.00
R0153:Zfp292 UTSW 4 34811185 missense probably benign 0.26
R0184:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34806281 missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34808227 missense probably benign 0.25
R0433:Zfp292 UTSW 4 34839959 missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34810059 missense probably benign 0.28
R0555:Zfp292 UTSW 4 34807194 missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34807399 missense probably benign 0.02
R0748:Zfp292 UTSW 4 34816424 splice site probably benign
R0782:Zfp292 UTSW 4 34839382 missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34809114 missense probably benign 0.00
R0879:Zfp292 UTSW 4 34811218 missense probably benign 0.00
R1083:Zfp292 UTSW 4 34807569 missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34805238 missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34805397 missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34808935 missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34811237 missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34811043 missense probably benign 0.02
R1837:Zfp292 UTSW 4 34810264 missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34807452 missense probably benign 0.22
R2107:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34810266 missense probably benign 0.13
R2182:Zfp292 UTSW 4 34807417 missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34807962 missense probably benign 0.07
R2306:Zfp292 UTSW 4 34809468 missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34811281 missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34806426 missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34808814 missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34810326 missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34807744 missense probably benign 0.00
R4006:Zfp292 UTSW 4 34809611 missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34806079 missense probably benign 0.04
R4641:Zfp292 UTSW 4 34807828 missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34807078 missense probably benign 0.00
R4718:Zfp292 UTSW 4 34819521 missense possibly damaging 0.92
R4865:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34808917 missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34839878 missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34809755 missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34805842 missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34807491 missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34806261 missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34811703 missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34806747 missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34805125 missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34805464 missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34811902 missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34808497 missense probably benign 0.13
R6209:Zfp292 UTSW 4 34809442 missense probably benign 0.14
R6275:Zfp292 UTSW 4 34808883 missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34816301 missense probably benign 0.21
R6747:Zfp292 UTSW 4 34806894 missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34807812 missense probably damaging 1.00
R7038:Zfp292 UTSW 4 34816357 missense probably damaging 1.00
R7056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R7088:Zfp292 UTSW 4 34806796 missense probably damaging 1.00
R7158:Zfp292 UTSW 4 34808679 missense probably benign
R7254:Zfp292 UTSW 4 34819476 missense probably damaging 0.98
R7350:Zfp292 UTSW 4 34806839 missense probably benign
R7378:Zfp292 UTSW 4 34808384 missense probably benign 0.26
R7589:Zfp292 UTSW 4 34806777 missense probably damaging 1.00
R7816:Zfp292 UTSW 4 34809865 missense probably benign 0.02
R7979:Zfp292 UTSW 4 34809198 missense probably benign 0.02
R7997:Zfp292 UTSW 4 34808688 missense probably damaging 0.96
R8129:Zfp292 UTSW 4 34807386 missense probably damaging 1.00
R8211:Zfp292 UTSW 4 34806163 missense probably benign 0.00
R8302:Zfp292 UTSW 4 34810893 missense possibly damaging 0.64
R8500:Zfp292 UTSW 4 34826691 critical splice donor site probably null
R8709:Zfp292 UTSW 4 34805982 missense probably damaging 1.00
R8947:Zfp292 UTSW 4 34811835 missense probably damaging 1.00
V7580:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
Z1177:Zfp292 UTSW 4 34811058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGACTGTTTAACATGCAGGG -3'
(R):5'- GAAGAGGCGTCTATTGTGTCC -3'

Sequencing Primer
(F):5'- CATGAGGGACAAACGAGTCTTTAG -3'
(R):5'- CCTCAATTGATGAACTGAATGACAG -3'
Posted On2019-10-17