Incidental Mutation 'R7535:Mysm1'
ID 583497
Institutional Source Beutler Lab
Gene Symbol Mysm1
Ensembl Gene ENSMUSG00000062627
Gene Name myb-like, SWIRM and MPN domains 1
Synonyms C130067A03Rik, C530050H10Rik
MMRRC Submission 045607-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.909) question?
Stock # R7535 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 94830277-94867337 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94840452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 655 (N655D)
Ref Sequence ENSEMBL: ENSMUSP00000075269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075872]
AlphaFold Q69Z66
Predicted Effect probably benign
Transcript: ENSMUST00000075872
AA Change: N655D

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075269
Gene: ENSMUSG00000062627
AA Change: N655D

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
SANT 114 162 3.24e-13 SMART
low complexity region 214 229 N/A INTRINSIC
Pfam:SWIRM 365 452 3.1e-22 PFAM
JAB_MPN 569 691 1.63e-4 SMART
Meta Mutation Damage Score 0.0985 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Homozygotes exhibit pigmentation, epidermis, hair follicle and hair cycle abnormalities. Abnormalities in behavior, the hematopoietic and immune systems, body size, metabolism, and skeletal and eye phenotypes are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,837,463 (GRCm39) L449Q probably benign Het
Agtpbp1 T C 13: 59,652,067 (GRCm39) T415A probably benign Het
Akt3 A T 1: 176,924,600 (GRCm39) V165D probably damaging Het
Cbr2 T A 11: 120,620,628 (GRCm39) I219F probably damaging Het
Cdh20 T A 1: 104,902,768 (GRCm39) D486E probably damaging Het
Cenpe A G 3: 134,949,523 (GRCm39) S103G possibly damaging Het
Chd4 T A 6: 125,105,836 (GRCm39) S1818T probably benign Het
Chst5 T C 8: 112,616,795 (GRCm39) D275G probably damaging Het
Clca3a1 A G 3: 144,724,328 (GRCm39) I244T probably damaging Het
Cyp2c54 A G 19: 40,058,716 (GRCm39) Y239H probably benign Het
Czib T G 4: 107,752,097 (GRCm39) S159A probably benign Het
Ddx25 A G 9: 35,454,951 (GRCm39) F446L possibly damaging Het
Dgkb T C 12: 38,186,646 (GRCm39) L265P probably damaging Het
Dis3 A G 14: 99,327,415 (GRCm39) S363P probably benign Het
Disp3 T C 4: 148,327,323 (GRCm39) E1187G probably damaging Het
Dop1b G A 16: 93,603,249 (GRCm39) G2061R probably damaging Het
Dsp T C 13: 38,376,765 (GRCm39) S1517P probably benign Het
Epg5 T A 18: 78,076,141 (GRCm39) V2513E probably benign Het
Fryl T A 5: 73,255,539 (GRCm39) T831S probably benign Het
Gm6309 A T 5: 146,105,100 (GRCm39) V271D probably damaging Het
H2-M2 G T 17: 37,793,528 (GRCm39) S159R probably benign Het
Helq A G 5: 100,937,999 (GRCm39) probably null Het
Herc1 G C 9: 66,382,135 (GRCm39) D3621H probably damaging Het
Hsd11b2 A T 8: 106,245,755 (GRCm39) I87F probably damaging Het
Ice2 A G 9: 69,339,360 (GRCm39) N959S probably damaging Het
Ifi47 T A 11: 48,987,452 (GRCm39) D406E probably damaging Het
Ifit3 T G 19: 34,565,280 (GRCm39) S275R probably damaging Het
Insl5 C A 4: 102,875,395 (GRCm39) K118N probably damaging Het
Irf7 A T 7: 140,844,550 (GRCm39) F158I probably benign Het
Kat2b T C 17: 53,931,431 (GRCm39) L143P probably damaging Het
Klk1b1 A T 7: 43,619,746 (GRCm39) N102Y probably damaging Het
Krt13 C T 11: 100,008,824 (GRCm39) G410S unknown Het
Larp6 A T 9: 60,631,437 (GRCm39) T70S probably benign Het
Lrrc37a T C 11: 103,392,683 (GRCm39) E914G possibly damaging Het
Mindy4 T C 6: 55,274,738 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myom2 A G 8: 15,167,679 (GRCm39) Y1088C probably damaging Het
Nbas T A 12: 13,329,390 (GRCm39) S112T probably damaging Het
Neb A G 2: 52,055,115 (GRCm39) probably null Het
Noxred1 G A 12: 87,280,206 (GRCm39) A42V probably benign Het
Olfm5 G A 7: 103,803,444 (GRCm39) P340S possibly damaging Het
Or11h4 G A 14: 50,974,122 (GRCm39) P166S probably benign Het
Or2l5 T C 16: 19,333,544 (GRCm39) T281A probably damaging Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Or5m8 T A 2: 85,822,245 (GRCm39) V28E probably benign Het
Or9i1b A G 19: 13,896,449 (GRCm39) K22E probably benign Het
Pccb A T 9: 100,876,615 (GRCm39) probably null Het
Pnn T A 12: 59,118,923 (GRCm39) V502E probably benign Het
Pole2 A T 12: 69,269,203 (GRCm39) I98K probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rasgrp4 A G 7: 28,838,484 (GRCm39) K111E probably benign Het
Rbbp6 G A 7: 122,589,366 (GRCm39) M351I probably benign Het
Rgs19 T G 2: 181,333,101 (GRCm39) H53P probably damaging Het
Rin1 A T 19: 5,102,564 (GRCm39) T369S probably benign Het
Rnaset2b G A 17: 7,259,138 (GRCm39) E135K possibly damaging Het
Rprd2 G A 3: 95,683,899 (GRCm39) P379S probably damaging Het
Sbno1 A G 5: 124,551,342 (GRCm39) L47P possibly damaging Het
Slamf6 T A 1: 171,747,325 (GRCm39) L29Q unknown Het
Slc16a14 T C 1: 84,890,843 (GRCm39) Y154C probably damaging Het
Slc22a29 A G 19: 8,147,342 (GRCm39) F340S probably damaging Het
Slc6a4 T G 11: 76,905,976 (GRCm39) I259S possibly damaging Het
Smarca4 G A 9: 21,558,921 (GRCm39) V651I possibly damaging Het
Susd5 C T 9: 113,893,108 (GRCm39) A62V possibly damaging Het
Syt1 T A 10: 108,463,283 (GRCm39) probably null Het
Taf10 T C 7: 105,390,117 (GRCm39) I218T probably benign Het
Tas1r1 C A 4: 152,112,819 (GRCm39) V745F probably benign Het
Tas2r125 C A 6: 132,887,287 (GRCm39) T225K probably damaging Het
Tcp11l2 G T 10: 84,430,523 (GRCm39) R216L possibly damaging Het
Tnks1bp1 C T 2: 84,893,624 (GRCm39) Q1184* probably null Het
Treml2 T A 17: 48,609,847 (GRCm39) V93D probably damaging Het
Trim11 G A 11: 58,872,891 (GRCm39) E192K probably damaging Het
Trim43a A G 9: 88,470,201 (GRCm39) K336E probably damaging Het
Tspan33 T A 6: 29,717,588 (GRCm39) I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 (GRCm39) C458Y probably damaging Het
Ttc6 A G 12: 57,623,305 (GRCm39) S235G probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Usp36 A T 11: 118,152,872 (GRCm39) S1084T possibly damaging Het
Vps39 T A 2: 120,155,176 (GRCm39) N550I probably damaging Het
Wdr47 A G 3: 108,537,027 (GRCm39) I572V probably benign Het
Zfp112 A T 7: 23,826,135 (GRCm39) Y705F probably damaging Het
Zfp282 A G 6: 47,881,878 (GRCm39) T522A probably benign Het
Zfp292 T C 4: 34,811,487 (GRCm39) D524G probably benign Het
Zfp90 A T 8: 107,150,900 (GRCm39) K204N possibly damaging Het
Zmym2 T C 14: 57,194,536 (GRCm39) S1265P probably damaging Het
Other mutations in Mysm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Mysm1 APN 4 94,861,146 (GRCm39) splice site probably benign
IGL00657:Mysm1 APN 4 94,848,602 (GRCm39) missense probably benign 0.17
IGL00908:Mysm1 APN 4 94,847,172 (GRCm39) missense probably damaging 1.00
IGL01095:Mysm1 APN 4 94,856,106 (GRCm39) critical splice donor site probably null
IGL02454:Mysm1 APN 4 94,858,741 (GRCm39) splice site probably benign
IGL02544:Mysm1 APN 4 94,840,543 (GRCm39) missense probably damaging 1.00
IGL02815:Mysm1 APN 4 94,845,285 (GRCm39) critical splice donor site probably null
IGL02966:Mysm1 APN 4 94,863,523 (GRCm39) missense probably benign 0.31
IGL03273:Mysm1 APN 4 94,853,955 (GRCm39) missense probably damaging 1.00
R1746:Mysm1 UTSW 4 94,836,648 (GRCm39) nonsense probably null
R1826:Mysm1 UTSW 4 94,858,923 (GRCm39) missense probably benign 0.01
R1980:Mysm1 UTSW 4 94,840,450 (GRCm39) missense probably benign 0.27
R3424:Mysm1 UTSW 4 94,853,558 (GRCm39) missense probably benign 0.05
R3700:Mysm1 UTSW 4 94,858,889 (GRCm39) missense probably benign 0.04
R4243:Mysm1 UTSW 4 94,857,248 (GRCm39) missense probably benign 0.15
R4798:Mysm1 UTSW 4 94,853,910 (GRCm39) missense probably benign 0.00
R4884:Mysm1 UTSW 4 94,847,185 (GRCm39) missense probably damaging 0.98
R4983:Mysm1 UTSW 4 94,861,207 (GRCm39) missense probably benign 0.01
R5024:Mysm1 UTSW 4 94,839,253 (GRCm39) missense possibly damaging 0.47
R5213:Mysm1 UTSW 4 94,836,614 (GRCm39) missense probably damaging 0.96
R5758:Mysm1 UTSW 4 94,840,598 (GRCm39) missense probably damaging 0.98
R6129:Mysm1 UTSW 4 94,856,192 (GRCm39) missense probably damaging 1.00
R7399:Mysm1 UTSW 4 94,849,964 (GRCm39) missense probably benign 0.29
R7793:Mysm1 UTSW 4 94,853,369 (GRCm39) missense probably damaging 0.99
R7861:Mysm1 UTSW 4 94,835,204 (GRCm39) makesense probably null
R7923:Mysm1 UTSW 4 94,850,002 (GRCm39) missense probably damaging 1.00
R8117:Mysm1 UTSW 4 94,848,627 (GRCm39) nonsense probably null
R8352:Mysm1 UTSW 4 94,863,510 (GRCm39) missense probably damaging 0.97
R8389:Mysm1 UTSW 4 94,853,849 (GRCm39) missense probably benign 0.00
R8452:Mysm1 UTSW 4 94,863,510 (GRCm39) missense probably damaging 0.97
R8738:Mysm1 UTSW 4 94,856,196 (GRCm39) missense probably damaging 1.00
R9036:Mysm1 UTSW 4 94,835,294 (GRCm39) missense probably benign 0.23
R9497:Mysm1 UTSW 4 94,848,635 (GRCm39) missense probably benign 0.06
X0021:Mysm1 UTSW 4 94,863,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGCTTATACTCAACTGCTG -3'
(R):5'- CCTTCAAGAACAATCTCTTACAGG -3'

Sequencing Primer
(F):5'- GCTGACCTTCCAAATGCTTACTAATG -3'
(R):5'- AATCTCTTACAGGTCTGTGCAGCAG -3'
Posted On 2019-10-17