Incidental Mutation 'R7535:Sbno1'
ID 583503
Institutional Source Beutler Lab
Gene Symbol Sbno1
Ensembl Gene ENSMUSG00000038095
Gene Name strawberry notch 1
Synonyms 9330180L10Rik, sno
MMRRC Submission 045607-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7535 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 124506765-124564059 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124551342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 47 (L47P)
Ref Sequence ENSEMBL: ENSMUSP00000142481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000196329] [ENSMUST00000196644] [ENSMUST00000196711] [ENSMUST00000197777] [ENSMUST00000198420] [ENSMUST00000199004] [ENSMUST00000199808] [ENSMUST00000200474]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000065263
AA Change: L47P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095
AA Change: L47P

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168651
AA Change: L47P

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095
AA Change: L47P

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196329
SMART Domains Protein: ENSMUSP00000143084
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
low complexity region 182 199 N/A INTRINSIC
Pfam:AAA_34 217 525 1.4e-139 PFAM
Pfam:ResIII 254 441 2.4e-8 PFAM
low complexity region 598 614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196644
AA Change: L47P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142827
Gene: ENSMUSG00000038095
AA Change: L47P

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 4.3e-136 PFAM
Pfam:ResIII 289 476 1.8e-6 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196711
SMART Domains Protein: ENSMUSP00000142980
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
low complexity region 182 199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197777
AA Change: L47P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000198420
SMART Domains Protein: ENSMUSP00000142416
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199004
AA Change: L47P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143314
Gene: ENSMUSG00000038095
AA Change: L47P

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199808
AA Change: L47P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095
AA Change: L47P

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 6e-139 PFAM
Pfam:ResIII 289 476 1.3e-7 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 4.6e-120 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200474
SMART Domains Protein: ENSMUSP00000143516
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 181 198 N/A INTRINSIC
Pfam:AAA_34 218 523 2.3e-141 PFAM
Pfam:ResIII 251 442 3.3e-7 PFAM
low complexity region 597 613 N/A INTRINSIC
low complexity region 691 712 N/A INTRINSIC
low complexity region 743 755 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,837,463 (GRCm39) L449Q probably benign Het
Agtpbp1 T C 13: 59,652,067 (GRCm39) T415A probably benign Het
Akt3 A T 1: 176,924,600 (GRCm39) V165D probably damaging Het
Cbr2 T A 11: 120,620,628 (GRCm39) I219F probably damaging Het
Cdh20 T A 1: 104,902,768 (GRCm39) D486E probably damaging Het
Cenpe A G 3: 134,949,523 (GRCm39) S103G possibly damaging Het
Chd4 T A 6: 125,105,836 (GRCm39) S1818T probably benign Het
Chst5 T C 8: 112,616,795 (GRCm39) D275G probably damaging Het
Clca3a1 A G 3: 144,724,328 (GRCm39) I244T probably damaging Het
Cyp2c54 A G 19: 40,058,716 (GRCm39) Y239H probably benign Het
Czib T G 4: 107,752,097 (GRCm39) S159A probably benign Het
Ddx25 A G 9: 35,454,951 (GRCm39) F446L possibly damaging Het
Dgkb T C 12: 38,186,646 (GRCm39) L265P probably damaging Het
Dis3 A G 14: 99,327,415 (GRCm39) S363P probably benign Het
Disp3 T C 4: 148,327,323 (GRCm39) E1187G probably damaging Het
Dop1b G A 16: 93,603,249 (GRCm39) G2061R probably damaging Het
Dsp T C 13: 38,376,765 (GRCm39) S1517P probably benign Het
Epg5 T A 18: 78,076,141 (GRCm39) V2513E probably benign Het
Fryl T A 5: 73,255,539 (GRCm39) T831S probably benign Het
Gm6309 A T 5: 146,105,100 (GRCm39) V271D probably damaging Het
H2-M2 G T 17: 37,793,528 (GRCm39) S159R probably benign Het
Helq A G 5: 100,937,999 (GRCm39) probably null Het
Herc1 G C 9: 66,382,135 (GRCm39) D3621H probably damaging Het
Hsd11b2 A T 8: 106,245,755 (GRCm39) I87F probably damaging Het
Ice2 A G 9: 69,339,360 (GRCm39) N959S probably damaging Het
Ifi47 T A 11: 48,987,452 (GRCm39) D406E probably damaging Het
Ifit3 T G 19: 34,565,280 (GRCm39) S275R probably damaging Het
Insl5 C A 4: 102,875,395 (GRCm39) K118N probably damaging Het
Irf7 A T 7: 140,844,550 (GRCm39) F158I probably benign Het
Kat2b T C 17: 53,931,431 (GRCm39) L143P probably damaging Het
Klk1b1 A T 7: 43,619,746 (GRCm39) N102Y probably damaging Het
Krt13 C T 11: 100,008,824 (GRCm39) G410S unknown Het
Larp6 A T 9: 60,631,437 (GRCm39) T70S probably benign Het
Lrrc37a T C 11: 103,392,683 (GRCm39) E914G possibly damaging Het
Mindy4 T C 6: 55,274,738 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myom2 A G 8: 15,167,679 (GRCm39) Y1088C probably damaging Het
Mysm1 T C 4: 94,840,452 (GRCm39) N655D probably benign Het
Nbas T A 12: 13,329,390 (GRCm39) S112T probably damaging Het
Neb A G 2: 52,055,115 (GRCm39) probably null Het
Noxred1 G A 12: 87,280,206 (GRCm39) A42V probably benign Het
Olfm5 G A 7: 103,803,444 (GRCm39) P340S possibly damaging Het
Or11h4 G A 14: 50,974,122 (GRCm39) P166S probably benign Het
Or2l5 T C 16: 19,333,544 (GRCm39) T281A probably damaging Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Or5m8 T A 2: 85,822,245 (GRCm39) V28E probably benign Het
Or9i1b A G 19: 13,896,449 (GRCm39) K22E probably benign Het
Pccb A T 9: 100,876,615 (GRCm39) probably null Het
Pnn T A 12: 59,118,923 (GRCm39) V502E probably benign Het
Pole2 A T 12: 69,269,203 (GRCm39) I98K probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rasgrp4 A G 7: 28,838,484 (GRCm39) K111E probably benign Het
Rbbp6 G A 7: 122,589,366 (GRCm39) M351I probably benign Het
Rgs19 T G 2: 181,333,101 (GRCm39) H53P probably damaging Het
Rin1 A T 19: 5,102,564 (GRCm39) T369S probably benign Het
Rnaset2b G A 17: 7,259,138 (GRCm39) E135K possibly damaging Het
Rprd2 G A 3: 95,683,899 (GRCm39) P379S probably damaging Het
Slamf6 T A 1: 171,747,325 (GRCm39) L29Q unknown Het
Slc16a14 T C 1: 84,890,843 (GRCm39) Y154C probably damaging Het
Slc22a29 A G 19: 8,147,342 (GRCm39) F340S probably damaging Het
Slc6a4 T G 11: 76,905,976 (GRCm39) I259S possibly damaging Het
Smarca4 G A 9: 21,558,921 (GRCm39) V651I possibly damaging Het
Susd5 C T 9: 113,893,108 (GRCm39) A62V possibly damaging Het
Syt1 T A 10: 108,463,283 (GRCm39) probably null Het
Taf10 T C 7: 105,390,117 (GRCm39) I218T probably benign Het
Tas1r1 C A 4: 152,112,819 (GRCm39) V745F probably benign Het
Tas2r125 C A 6: 132,887,287 (GRCm39) T225K probably damaging Het
Tcp11l2 G T 10: 84,430,523 (GRCm39) R216L possibly damaging Het
Tnks1bp1 C T 2: 84,893,624 (GRCm39) Q1184* probably null Het
Treml2 T A 17: 48,609,847 (GRCm39) V93D probably damaging Het
Trim11 G A 11: 58,872,891 (GRCm39) E192K probably damaging Het
Trim43a A G 9: 88,470,201 (GRCm39) K336E probably damaging Het
Tspan33 T A 6: 29,717,588 (GRCm39) I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 (GRCm39) C458Y probably damaging Het
Ttc6 A G 12: 57,623,305 (GRCm39) S235G probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Usp36 A T 11: 118,152,872 (GRCm39) S1084T possibly damaging Het
Vps39 T A 2: 120,155,176 (GRCm39) N550I probably damaging Het
Wdr47 A G 3: 108,537,027 (GRCm39) I572V probably benign Het
Zfp112 A T 7: 23,826,135 (GRCm39) Y705F probably damaging Het
Zfp282 A G 6: 47,881,878 (GRCm39) T522A probably benign Het
Zfp292 T C 4: 34,811,487 (GRCm39) D524G probably benign Het
Zfp90 A T 8: 107,150,900 (GRCm39) K204N possibly damaging Het
Zmym2 T C 14: 57,194,536 (GRCm39) S1265P probably damaging Het
Other mutations in Sbno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Sbno1 APN 5 124,540,268 (GRCm39) missense probably damaging 1.00
IGL01154:Sbno1 APN 5 124,548,312 (GRCm39) missense probably damaging 1.00
IGL01309:Sbno1 APN 5 124,519,769 (GRCm39) missense probably benign 0.41
IGL01330:Sbno1 APN 5 124,530,042 (GRCm39) missense probably damaging 1.00
IGL01541:Sbno1 APN 5 124,516,618 (GRCm39) splice site probably benign
IGL01800:Sbno1 APN 5 124,519,568 (GRCm39) splice site probably benign
IGL01987:Sbno1 APN 5 124,542,282 (GRCm39) missense probably damaging 1.00
IGL02178:Sbno1 APN 5 124,538,258 (GRCm39) splice site probably null
IGL02544:Sbno1 APN 5 124,542,046 (GRCm39) missense probably damaging 0.99
IGL02572:Sbno1 APN 5 124,519,740 (GRCm39) splice site probably benign
IGL02592:Sbno1 APN 5 124,538,872 (GRCm39) missense probably damaging 1.00
IGL03033:Sbno1 APN 5 124,514,213 (GRCm39) missense probably damaging 0.97
IGL03089:Sbno1 APN 5 124,525,374 (GRCm39) splice site probably benign
IGL03131:Sbno1 APN 5 124,526,668 (GRCm39) missense probably damaging 1.00
Decrement UTSW 5 124,538,910 (GRCm39) missense probably damaging 1.00
R0200:Sbno1 UTSW 5 124,522,604 (GRCm39) missense probably damaging 1.00
R0217:Sbno1 UTSW 5 124,542,387 (GRCm39) critical splice acceptor site probably null
R0233:Sbno1 UTSW 5 124,514,289 (GRCm39) missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124,514,289 (GRCm39) missense probably damaging 1.00
R0334:Sbno1 UTSW 5 124,524,931 (GRCm39) missense possibly damaging 0.79
R0401:Sbno1 UTSW 5 124,548,348 (GRCm39) missense probably damaging 0.96
R0608:Sbno1 UTSW 5 124,522,604 (GRCm39) missense probably damaging 1.00
R0615:Sbno1 UTSW 5 124,548,202 (GRCm39) missense probably damaging 1.00
R0653:Sbno1 UTSW 5 124,524,955 (GRCm39) missense possibly damaging 0.79
R0655:Sbno1 UTSW 5 124,514,212 (GRCm39) missense possibly damaging 0.95
R1037:Sbno1 UTSW 5 124,531,975 (GRCm39) missense possibly damaging 0.92
R1439:Sbno1 UTSW 5 124,522,523 (GRCm39) splice site probably benign
R1522:Sbno1 UTSW 5 124,530,675 (GRCm39) missense probably damaging 1.00
R1590:Sbno1 UTSW 5 124,522,567 (GRCm39) missense possibly damaging 0.55
R1618:Sbno1 UTSW 5 124,542,279 (GRCm39) missense probably damaging 1.00
R1671:Sbno1 UTSW 5 124,530,130 (GRCm39) splice site probably null
R1779:Sbno1 UTSW 5 124,526,580 (GRCm39) unclassified probably benign
R2103:Sbno1 UTSW 5 124,532,000 (GRCm39) missense probably damaging 0.98
R2136:Sbno1 UTSW 5 124,525,597 (GRCm39) splice site probably null
R2149:Sbno1 UTSW 5 124,540,182 (GRCm39) splice site probably null
R2153:Sbno1 UTSW 5 124,516,606 (GRCm39) missense probably benign
R2154:Sbno1 UTSW 5 124,516,574 (GRCm39) missense probably benign
R2231:Sbno1 UTSW 5 124,543,767 (GRCm39) missense probably damaging 1.00
R2879:Sbno1 UTSW 5 124,526,635 (GRCm39) missense probably damaging 1.00
R3004:Sbno1 UTSW 5 124,519,771 (GRCm39) missense probably damaging 0.96
R3922:Sbno1 UTSW 5 124,519,993 (GRCm39) missense probably damaging 1.00
R4061:Sbno1 UTSW 5 124,526,635 (GRCm39) missense probably damaging 1.00
R4096:Sbno1 UTSW 5 124,529,983 (GRCm39) critical splice donor site probably null
R4612:Sbno1 UTSW 5 124,542,087 (GRCm39) missense probably damaging 1.00
R4879:Sbno1 UTSW 5 124,542,087 (GRCm39) missense probably damaging 1.00
R4937:Sbno1 UTSW 5 124,512,672 (GRCm39) missense possibly damaging 0.93
R4990:Sbno1 UTSW 5 124,538,228 (GRCm39) missense probably damaging 1.00
R5341:Sbno1 UTSW 5 124,546,538 (GRCm39) critical splice donor site probably null
R5365:Sbno1 UTSW 5 124,519,929 (GRCm39) frame shift probably null
R5399:Sbno1 UTSW 5 124,530,804 (GRCm39) missense probably benign 0.09
R5704:Sbno1 UTSW 5 124,533,956 (GRCm39) critical splice donor site probably null
R5898:Sbno1 UTSW 5 124,524,854 (GRCm39) intron probably benign
R6136:Sbno1 UTSW 5 124,516,554 (GRCm39) missense probably benign 0.41
R6154:Sbno1 UTSW 5 124,516,542 (GRCm39) missense possibly damaging 0.94
R6412:Sbno1 UTSW 5 124,530,777 (GRCm39) missense probably damaging 0.99
R6414:Sbno1 UTSW 5 124,533,994 (GRCm39) missense probably benign 0.28
R6454:Sbno1 UTSW 5 124,538,910 (GRCm39) missense probably damaging 1.00
R7085:Sbno1 UTSW 5 124,519,783 (GRCm39) missense possibly damaging 0.83
R7176:Sbno1 UTSW 5 124,530,944 (GRCm39) missense probably benign 0.21
R7219:Sbno1 UTSW 5 124,543,722 (GRCm39) missense probably benign 0.00
R7673:Sbno1 UTSW 5 124,551,279 (GRCm39) missense probably benign
R7692:Sbno1 UTSW 5 124,543,709 (GRCm39) missense probably benign 0.35
R7745:Sbno1 UTSW 5 124,530,962 (GRCm39) missense probably benign 0.00
R7762:Sbno1 UTSW 5 124,512,729 (GRCm39) missense probably benign 0.19
R8012:Sbno1 UTSW 5 124,522,565 (GRCm39) missense probably benign 0.43
R8142:Sbno1 UTSW 5 124,546,608 (GRCm39) missense probably benign
R8164:Sbno1 UTSW 5 124,512,684 (GRCm39) missense probably benign 0.13
R8259:Sbno1 UTSW 5 124,519,759 (GRCm39) missense probably damaging 0.99
R8289:Sbno1 UTSW 5 124,542,068 (GRCm39) missense probably damaging 1.00
R8717:Sbno1 UTSW 5 124,512,618 (GRCm39) missense possibly damaging 0.85
R9045:Sbno1 UTSW 5 124,543,720 (GRCm39) missense probably benign 0.14
R9149:Sbno1 UTSW 5 124,519,762 (GRCm39) missense probably benign 0.01
R9529:Sbno1 UTSW 5 124,517,413 (GRCm39) nonsense probably null
Z1088:Sbno1 UTSW 5 124,542,367 (GRCm39) missense probably damaging 0.98
Z1088:Sbno1 UTSW 5 124,532,021 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGGCTAGCTAGGGATAAAGATCTTAC -3'
(R):5'- ATGCTGATCAAGTTTAGTCTGTTAC -3'

Sequencing Primer
(F):5'- AACGATCTCTGCAGCTCT -3'
(R):5'- TCAAGGATTCTGCAGGCTAC -3'
Posted On 2019-10-17