Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Chd4'

583509

Institutional Source

Beutler Lab

Gene Symbol

Chd4

Ensembl Gene

ENSMUSG00000063870

Gene Name

chromodomain helicase DNA binding protein 4

Synonyms

D6Ertd380e, Mi-2beta, 9530019N15Rik

MMRRC Submission

045607-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125095981-125130591 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 125128873 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1818 (S1818T)

Ref Sequence

ENSEMBL: ENSMUSP00000060054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044200] [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000204185]

AlphaFold

Q6PDQ2

Predicted Effect

probably benign
Transcript: ENSMUST00000044200

SMART Domains

Protein: ENSMUSP00000047123
Gene: ENSMUSG00000038279

Domain	Start	End	E-Value	Type
low complexity region	41	57	N/A	INTRINSIC
low complexity region	97	109	N/A	INTRINSIC
low complexity region	166	176	N/A	INTRINSIC
Pfam:Methyltr_RsmF_N	268	359	2.9e-12	PFAM
Pfam:Nol1_Nop2_Fmu	362	570	2e-86	PFAM
Pfam:P120R	609	630	2.7e-11	PFAM
Pfam:P120R	663	685	1.1e-12	PFAM
low complexity region	729	745	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000056889
AA Change: S1818T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870
AA Change: S1818T

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	7.7e-35	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	365	408	7.17e-15	SMART
RING	366	407	7.46e-1	SMART
low complexity region	424	443	N/A	INTRINSIC
PHD	444	487	4.41e-15	SMART
RING	445	486	2.63e0	SMART
CHROMO	492	572	8.11e-17	SMART
CHROMO	613	670	1.98e-11	SMART
low complexity region	675	694	N/A	INTRINSIC
DEXDc	715	927	2.73e-37	SMART
low complexity region	1044	1056	N/A	INTRINSIC
HELICc	1073	1157	7.61e-27	SMART
DUF1087	1282	1346	5.56e-33	SMART
DUF1086	1359	1516	4.05e-108	SMART
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1590	1633	N/A	INTRINSIC
low complexity region	1635	1653	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
Pfam:CHDCT2	1727	1899	1.9e-98	PFAM
low complexity region	1903	1915	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112390
AA Change: S1825T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870
AA Change: S1825T

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	87	99	N/A	INTRINSIC
low complexity region	114	151	N/A	INTRINSIC
Pfam:CHDNT	164	217	2e-28	PFAM
low complexity region	224	256	N/A	INTRINSIC
low complexity region	278	298	N/A	INTRINSIC
low complexity region	303	325	N/A	INTRINSIC
low complexity region	328	354	N/A	INTRINSIC
PHD	372	415	7.17e-15	SMART
RING	373	414	7.46e-1	SMART
low complexity region	431	450	N/A	INTRINSIC
PHD	451	494	4.41e-15	SMART
RING	452	493	2.63e0	SMART
CHROMO	499	579	8.11e-17	SMART
CHROMO	620	677	1.98e-11	SMART
low complexity region	682	701	N/A	INTRINSIC
DEXDc	722	934	2.73e-37	SMART
low complexity region	1051	1063	N/A	INTRINSIC
HELICc	1080	1164	7.61e-27	SMART
DUF1087	1289	1353	5.56e-33	SMART
DUF1086	1366	1523	4.05e-108	SMART
low complexity region	1533	1547	N/A	INTRINSIC
low complexity region	1567	1585	N/A	INTRINSIC
low complexity region	1597	1640	N/A	INTRINSIC
low complexity region	1642	1660	N/A	INTRINSIC
low complexity region	1668	1681	N/A	INTRINSIC
Pfam:CHDCT2	1735	1906	4.3e-90	PFAM
low complexity region	1910	1922	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112392
AA Change: S1805T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870
AA Change: S1805T

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	1.1e-34	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	352	395	7.17e-15	SMART
RING	353	394	7.46e-1	SMART
low complexity region	411	430	N/A	INTRINSIC
PHD	431	474	4.41e-15	SMART
RING	432	473	2.63e0	SMART
CHROMO	479	559	8.11e-17	SMART
CHROMO	600	657	1.98e-11	SMART
low complexity region	662	681	N/A	INTRINSIC
DEXDc	702	914	2.73e-37	SMART
low complexity region	1031	1043	N/A	INTRINSIC
HELICc	1060	1144	7.61e-27	SMART
DUF1087	1269	1333	5.56e-33	SMART
DUF1086	1346	1503	4.05e-108	SMART
low complexity region	1513	1527	N/A	INTRINSIC
low complexity region	1547	1565	N/A	INTRINSIC
low complexity region	1577	1620	N/A	INTRINSIC
low complexity region	1622	1640	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
Pfam:CHDCT2	1714	1886	2.8e-98	PFAM
low complexity region	1890	1902	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000204185

SMART Domains

Protein: ENSMUSP00000145333
Gene: ENSMUSG00000038279

Domain	Start	End	E-Value	Type
low complexity region	41	57	N/A	INTRINSIC
low complexity region	97	109	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Chd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Chd4	APN	6	125109897	missense	probably damaging	1.00
IGL00917:Chd4	APN	6	125104946	missense	possibly damaging	0.95
IGL01088:Chd4	APN	6	125122468	unclassified	probably benign
IGL02005:Chd4	APN	6	125128816	missense	possibly damaging	0.71
IGL02405:Chd4	APN	6	125097227	missense	probably benign	0.06
IGL02707:Chd4	APN	6	125108767	missense	probably damaging	1.00
IGL02976:Chd4	APN	6	125121368	missense	probably damaging	1.00
IGL03001:Chd4	APN	6	125101566	missense	possibly damaging	0.93
FR4304:Chd4	UTSW	6	125122144	unclassified	probably benign
FR4589:Chd4	UTSW	6	125122133	missense	probably benign	0.02
FR4589:Chd4	UTSW	6	125122139	unclassified	probably benign
FR4737:Chd4	UTSW	6	125122131	unclassified	probably benign
FR4976:Chd4	UTSW	6	125122131	unclassified	probably benign
R0311:Chd4	UTSW	6	125101665	missense	probably benign	0.15
R0414:Chd4	UTSW	6	125107480	missense	probably damaging	1.00
R0647:Chd4	UTSW	6	125109123	missense	probably damaging	1.00
R0656:Chd4	UTSW	6	125102967	missense	probably damaging	0.98
R1342:Chd4	UTSW	6	125097188	missense	probably benign	0.40
R1651:Chd4	UTSW	6	125123584	missense	possibly damaging	0.92
R1850:Chd4	UTSW	6	125121656	missense	probably damaging	1.00
R2190:Chd4	UTSW	6	125114297	missense	probably benign	0.18
R2192:Chd4	UTSW	6	125105357	missense	probably damaging	0.99
R2858:Chd4	UTSW	6	125104886	missense	probably damaging	0.99
R3406:Chd4	UTSW	6	125122007	missense	probably benign	0.09
R3431:Chd4	UTSW	6	125120560	splice site	probably benign
R4330:Chd4	UTSW	6	125101602	missense	probably benign	0.29
R4394:Chd4	UTSW	6	125121618	missense	probably damaging	0.99
R4538:Chd4	UTSW	6	125120686	missense	probably damaging	0.99
R4664:Chd4	UTSW	6	125101502	missense	possibly damaging	0.58
R4805:Chd4	UTSW	6	125128945	missense	possibly damaging	0.86
R5050:Chd4	UTSW	6	125107480	missense	probably damaging	1.00
R5055:Chd4	UTSW	6	125100986	missense	possibly damaging	0.65
R5232:Chd4	UTSW	6	125121310	missense	probably damaging	1.00
R5314:Chd4	UTSW	6	125100588	missense	probably damaging	0.96
R5343:Chd4	UTSW	6	125120363	missense	probably damaging	1.00
R5502:Chd4	UTSW	6	125105276	missense	possibly damaging	0.83
R5613:Chd4	UTSW	6	125120546	missense	probably damaging	0.99
R6211:Chd4	UTSW	6	125101285	missense	possibly damaging	0.82
R6606:Chd4	UTSW	6	125109426	missense	probably damaging	0.99
R6753:Chd4	UTSW	6	125114300	missense	probably benign	0.01
R6808:Chd4	UTSW	6	125122123	missense	possibly damaging	0.53
R6939:Chd4	UTSW	6	125106538	missense	probably damaging	0.99
R6968:Chd4	UTSW	6	125108318	missense	probably damaging	1.00
R6973:Chd4	UTSW	6	125122862	missense	possibly damaging	0.53
R6992:Chd4	UTSW	6	125114376	missense	probably benign	0.14
R7058:Chd4	UTSW	6	125108442	missense	possibly damaging	0.74
R7081:Chd4	UTSW	6	125129985	missense	unknown
R7253:Chd4	UTSW	6	125106592	splice site	probably null
R7423:Chd4	UTSW	6	125128859	missense	possibly damaging	0.92
R7566:Chd4	UTSW	6	125101903	missense	possibly damaging	0.86
R8053:Chd4	UTSW	6	125128816	nonsense	probably null
R8155:Chd4	UTSW	6	125105324	missense	probably benign	0.00
R8711:Chd4	UTSW	6	125123522	unclassified	probably benign
R8783:Chd4	UTSW	6	125123384	missense	possibly damaging	0.53
R9020:Chd4	UTSW	6	125107506	missense	probably damaging	1.00
R9093:Chd4	UTSW	6	125114011	missense	probably benign	0.13
R9417:Chd4	UTSW	6	125120725	missense	probably damaging	0.99
R9509:Chd4	UTSW	6	125122522	missense	possibly damaging	0.96
RF046:Chd4	UTSW	6	125122131	unclassified	probably benign
RF052:Chd4	UTSW	6	125122145	unclassified	probably benign
RF058:Chd4	UTSW	6	125122131	unclassified	probably benign
RF060:Chd4	UTSW	6	125122145	unclassified	probably benign
X0025:Chd4	UTSW	6	125106467	nonsense	probably null
X0027:Chd4	UTSW	6	125102164	missense	probably damaging	0.98
X0063:Chd4	UTSW	6	125114015	missense	probably damaging	1.00
Z1176:Chd4	UTSW	6	125100860	missense	possibly damaging	0.93
Z1176:Chd4	UTSW	6	125101598	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- GGGCCGGCATTTCTTTACAG -3'
(R):5'- CTCGGCAGACAGTTTGGAAATAAG -3'

Sequencing Primer
(F):5'- ACAGATTCTTGCTAGCTGGAG -3'
(R):5'- CAGTTTGGAAATAAGCTGTTTATGG -3'

Posted On

2019-10-17