Incidental Mutation 'R7535:Chd4'
ID583509
Institutional Source Beutler Lab
Gene Symbol Chd4
Ensembl Gene ENSMUSG00000063870
Gene Namechromodomain helicase DNA binding protein 4
SynonymsD6Ertd380e, Mi-2beta, 9530019N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125095981-125130591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125128873 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1818 (S1818T)
Ref Sequence ENSEMBL: ENSMUSP00000060054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044200] [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000204185]
Predicted Effect probably benign
Transcript: ENSMUST00000044200
SMART Domains Protein: ENSMUSP00000047123
Gene: ENSMUSG00000038279

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
Pfam:Methyltr_RsmF_N 268 359 2.9e-12 PFAM
Pfam:Nol1_Nop2_Fmu 362 570 2e-86 PFAM
Pfam:P120R 609 630 2.7e-11 PFAM
Pfam:P120R 663 685 1.1e-12 PFAM
low complexity region 729 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056889
AA Change: S1818T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870
AA Change: S1818T

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 7.7e-35 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 365 408 7.17e-15 SMART
RING 366 407 7.46e-1 SMART
low complexity region 424 443 N/A INTRINSIC
PHD 444 487 4.41e-15 SMART
RING 445 486 2.63e0 SMART
CHROMO 492 572 8.11e-17 SMART
CHROMO 613 670 1.98e-11 SMART
low complexity region 675 694 N/A INTRINSIC
DEXDc 715 927 2.73e-37 SMART
low complexity region 1044 1056 N/A INTRINSIC
HELICc 1073 1157 7.61e-27 SMART
DUF1087 1282 1346 5.56e-33 SMART
DUF1086 1359 1516 4.05e-108 SMART
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1590 1633 N/A INTRINSIC
low complexity region 1635 1653 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
Pfam:CHDCT2 1727 1899 1.9e-98 PFAM
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112390
AA Change: S1825T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870
AA Change: S1825T

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 114 151 N/A INTRINSIC
Pfam:CHDNT 164 217 2e-28 PFAM
low complexity region 224 256 N/A INTRINSIC
low complexity region 278 298 N/A INTRINSIC
low complexity region 303 325 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
PHD 372 415 7.17e-15 SMART
RING 373 414 7.46e-1 SMART
low complexity region 431 450 N/A INTRINSIC
PHD 451 494 4.41e-15 SMART
RING 452 493 2.63e0 SMART
CHROMO 499 579 8.11e-17 SMART
CHROMO 620 677 1.98e-11 SMART
low complexity region 682 701 N/A INTRINSIC
DEXDc 722 934 2.73e-37 SMART
low complexity region 1051 1063 N/A INTRINSIC
HELICc 1080 1164 7.61e-27 SMART
DUF1087 1289 1353 5.56e-33 SMART
DUF1086 1366 1523 4.05e-108 SMART
low complexity region 1533 1547 N/A INTRINSIC
low complexity region 1567 1585 N/A INTRINSIC
low complexity region 1597 1640 N/A INTRINSIC
low complexity region 1642 1660 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
Pfam:CHDCT2 1735 1906 4.3e-90 PFAM
low complexity region 1910 1922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112392
AA Change: S1805T

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870
AA Change: S1805T

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 1.1e-34 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 352 395 7.17e-15 SMART
RING 353 394 7.46e-1 SMART
low complexity region 411 430 N/A INTRINSIC
PHD 431 474 4.41e-15 SMART
RING 432 473 2.63e0 SMART
CHROMO 479 559 8.11e-17 SMART
CHROMO 600 657 1.98e-11 SMART
low complexity region 662 681 N/A INTRINSIC
DEXDc 702 914 2.73e-37 SMART
low complexity region 1031 1043 N/A INTRINSIC
HELICc 1060 1144 7.61e-27 SMART
DUF1087 1269 1333 5.56e-33 SMART
DUF1086 1346 1503 4.05e-108 SMART
low complexity region 1513 1527 N/A INTRINSIC
low complexity region 1547 1565 N/A INTRINSIC
low complexity region 1577 1620 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Pfam:CHDCT2 1714 1886 2.8e-98 PFAM
low complexity region 1890 1902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204185
SMART Domains Protein: ENSMUSP00000145333
Gene: ENSMUSG00000038279

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Chd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Chd4 APN 6 125109897 missense probably damaging 1.00
IGL00917:Chd4 APN 6 125104946 missense possibly damaging 0.95
IGL01088:Chd4 APN 6 125122468 unclassified probably benign
IGL02005:Chd4 APN 6 125128816 missense possibly damaging 0.71
IGL02405:Chd4 APN 6 125097227 missense probably benign 0.06
IGL02707:Chd4 APN 6 125108767 missense probably damaging 1.00
IGL02976:Chd4 APN 6 125121368 missense probably damaging 1.00
IGL03001:Chd4 APN 6 125101566 missense possibly damaging 0.93
FR4304:Chd4 UTSW 6 125122144 unclassified probably benign
FR4589:Chd4 UTSW 6 125122133 missense probably benign 0.02
FR4589:Chd4 UTSW 6 125122139 unclassified probably benign
FR4737:Chd4 UTSW 6 125122131 unclassified probably benign
FR4976:Chd4 UTSW 6 125122131 unclassified probably benign
R0311:Chd4 UTSW 6 125101665 missense probably benign 0.15
R0414:Chd4 UTSW 6 125107480 missense probably damaging 1.00
R0647:Chd4 UTSW 6 125109123 missense probably damaging 1.00
R0656:Chd4 UTSW 6 125102967 missense probably damaging 0.98
R1342:Chd4 UTSW 6 125097188 missense probably benign 0.40
R1651:Chd4 UTSW 6 125123584 missense possibly damaging 0.92
R1850:Chd4 UTSW 6 125121656 missense probably damaging 1.00
R2190:Chd4 UTSW 6 125114297 missense probably benign 0.18
R2192:Chd4 UTSW 6 125105357 missense probably damaging 0.99
R2858:Chd4 UTSW 6 125104886 missense probably damaging 0.99
R3406:Chd4 UTSW 6 125122007 missense probably benign 0.09
R3431:Chd4 UTSW 6 125120560 splice site probably benign
R4330:Chd4 UTSW 6 125101602 missense probably benign 0.29
R4394:Chd4 UTSW 6 125121618 missense probably damaging 0.99
R4538:Chd4 UTSW 6 125120686 missense probably damaging 0.99
R4664:Chd4 UTSW 6 125101502 missense possibly damaging 0.58
R4805:Chd4 UTSW 6 125128945 missense possibly damaging 0.86
R5050:Chd4 UTSW 6 125107480 missense probably damaging 1.00
R5055:Chd4 UTSW 6 125100986 missense possibly damaging 0.65
R5232:Chd4 UTSW 6 125121310 missense probably damaging 1.00
R5314:Chd4 UTSW 6 125100588 missense probably damaging 0.96
R5343:Chd4 UTSW 6 125120363 missense probably damaging 1.00
R5502:Chd4 UTSW 6 125105276 missense possibly damaging 0.83
R5613:Chd4 UTSW 6 125120546 missense probably damaging 0.99
R6211:Chd4 UTSW 6 125101285 missense possibly damaging 0.82
R6606:Chd4 UTSW 6 125109426 missense probably damaging 0.99
R6753:Chd4 UTSW 6 125114300 missense probably benign 0.01
R6808:Chd4 UTSW 6 125122123 missense possibly damaging 0.53
R6939:Chd4 UTSW 6 125106538 missense probably damaging 0.99
R6968:Chd4 UTSW 6 125108318 missense probably damaging 1.00
R6973:Chd4 UTSW 6 125122862 missense possibly damaging 0.53
R6992:Chd4 UTSW 6 125114376 missense probably benign 0.14
R7058:Chd4 UTSW 6 125108442 missense possibly damaging 0.74
R7081:Chd4 UTSW 6 125129985 missense unknown
R7253:Chd4 UTSW 6 125106592 splice site probably null
R7423:Chd4 UTSW 6 125128859 missense possibly damaging 0.92
R7566:Chd4 UTSW 6 125101903 missense possibly damaging 0.86
R8053:Chd4 UTSW 6 125128816 nonsense probably null
R8155:Chd4 UTSW 6 125105324 missense probably benign 0.00
RF046:Chd4 UTSW 6 125122131 unclassified probably benign
RF052:Chd4 UTSW 6 125122145 unclassified probably benign
RF058:Chd4 UTSW 6 125122131 unclassified probably benign
RF060:Chd4 UTSW 6 125122145 unclassified probably benign
X0025:Chd4 UTSW 6 125106467 nonsense probably null
X0027:Chd4 UTSW 6 125102164 missense probably damaging 0.98
X0063:Chd4 UTSW 6 125114015 missense probably damaging 1.00
Z1176:Chd4 UTSW 6 125100860 missense possibly damaging 0.93
Z1176:Chd4 UTSW 6 125101598 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GGGCCGGCATTTCTTTACAG -3'
(R):5'- CTCGGCAGACAGTTTGGAAATAAG -3'

Sequencing Primer
(F):5'- ACAGATTCTTGCTAGCTGGAG -3'
(R):5'- CAGTTTGGAAATAAGCTGTTTATGG -3'
Posted On2019-10-17