Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Klk1b1'

583514

Institutional Source

Beutler Lab

Gene Symbol

Klk1b1

Ensembl Gene

ENSMUSG00000063133

Gene Name

kallikrein 1-related peptidase b1

Synonyms

mGK-1, tissue kallikrein, TK, Klk1, mK1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43966751-43971318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43970322 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 102 (N102Y)

Ref Sequence

ENSEMBL: ENSMUSP00000077879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078835]

AlphaFold

P00755

Predicted Effect

probably damaging
Transcript: ENSMUST00000078835
AA Change: N102Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077879
Gene: ENSMUSG00000063133
AA Change: N102Y

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Tryp_SPc	24	253	1.25e-98	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice display decreased left ventricular contractility, cardiac output, and stroke volume, a thin left ventricular wall, and impaired vasodilation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Klk1b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Klk1b1	APN	7	43971169	missense	possibly damaging	0.83
IGL02794:Klk1b1	APN	7	43970365	missense	possibly damaging	0.62
IGL03266:Klk1b1	APN	7	43970476	missense	probably benign	0.18
R0324:Klk1b1	UTSW	7	43970741	nonsense	probably null
R0689:Klk1b1	UTSW	7	43970719	missense	probably benign
R1552:Klk1b1	UTSW	7	43969343	missense	probably damaging	1.00
R1697:Klk1b1	UTSW	7	43970326	missense	probably benign	0.01
R1737:Klk1b1	UTSW	7	43970359	missense	probably benign	0.01
R2060:Klk1b1	UTSW	7	43970623	missense	possibly damaging	0.73
R2159:Klk1b1	UTSW	7	43970433	missense	probably damaging	0.97
R2177:Klk1b1	UTSW	7	43969271	missense	possibly damaging	0.63
R2213:Klk1b1	UTSW	7	43970481	missense	probably damaging	1.00
R2509:Klk1b1	UTSW	7	43969379	missense	probably damaging	1.00
R2510:Klk1b1	UTSW	7	43969379	missense	probably damaging	1.00
R3849:Klk1b1	UTSW	7	43969327	missense	probably damaging	1.00
R5567:Klk1b1	UTSW	7	43971169	missense	probably damaging	0.99
R6191:Klk1b1	UTSW	7	43970657	missense	probably damaging	1.00
R7162:Klk1b1	UTSW	7	43969247	missense	probably damaging	0.99
R7752:Klk1b1	UTSW	7	43971245	missense	probably damaging	1.00
R7901:Klk1b1	UTSW	7	43971245	missense	probably damaging	1.00
R8320:Klk1b1	UTSW	7	43970343	missense	possibly damaging	0.86
R8379:Klk1b1	UTSW	7	43970343	missense	possibly damaging	0.86
R8381:Klk1b1	UTSW	7	43970343	missense	possibly damaging	0.86
R8383:Klk1b1	UTSW	7	43970343	missense	possibly damaging	0.86
R8511:Klk1b1	UTSW	7	43970343	missense	possibly damaging	0.86
R8867:Klk1b1	UTSW	7	43970323	missense	probably damaging	0.98
R9089:Klk1b1	UTSW	7	43971244	missense	possibly damaging	0.77
R9179:Klk1b1	UTSW	7	43969291	missense	probably damaging	1.00
R9761:Klk1b1	UTSW	7	43969315	missense	possibly damaging	0.79
X0012:Klk1b1	UTSW	7	43970659	missense	probably benign	0.05
Z1088:Klk1b1	UTSW	7	43970401	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TACAGACCTGTCCTAGCTGC -3'
(R):5'- CAGGTATAATGCTGCCCCAG -3'

Sequencing Primer
(F):5'- TGAGCAGCTCTCAGGTCTG -3'
(R):5'- GATGGGCTTCACAACATCT -3'

Posted On

2019-10-17