Incidental Mutation 'R7535:Klk1b1'
ID583514
Institutional Source Beutler Lab
Gene Symbol Klk1b1
Ensembl Gene ENSMUSG00000063133
Gene Namekallikrein 1-related peptidase b1
SynonymsmGK-1, tissue kallikrein, TK, Klk1, mK1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7535 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43966751-43971318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43970322 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 102 (N102Y)
Ref Sequence ENSEMBL: ENSMUSP00000077879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078835]
Predicted Effect probably damaging
Transcript: ENSMUST00000078835
AA Change: N102Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077879
Gene: ENSMUSG00000063133
AA Change: N102Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.25e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice display decreased left ventricular contractility, cardiac output, and stroke volume, a thin left ventricular wall, and impaired vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Klk1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Klk1b1 APN 7 43971169 missense possibly damaging 0.83
IGL02794:Klk1b1 APN 7 43970365 missense possibly damaging 0.62
IGL03266:Klk1b1 APN 7 43970476 missense probably benign 0.18
R0324:Klk1b1 UTSW 7 43970741 nonsense probably null
R0689:Klk1b1 UTSW 7 43970719 missense probably benign
R1552:Klk1b1 UTSW 7 43969343 missense probably damaging 1.00
R1697:Klk1b1 UTSW 7 43970326 missense probably benign 0.01
R1737:Klk1b1 UTSW 7 43970359 missense probably benign 0.01
R2060:Klk1b1 UTSW 7 43970623 missense possibly damaging 0.73
R2159:Klk1b1 UTSW 7 43970433 missense probably damaging 0.97
R2177:Klk1b1 UTSW 7 43969271 missense possibly damaging 0.63
R2213:Klk1b1 UTSW 7 43970481 missense probably damaging 1.00
R2509:Klk1b1 UTSW 7 43969379 missense probably damaging 1.00
R2510:Klk1b1 UTSW 7 43969379 missense probably damaging 1.00
R3849:Klk1b1 UTSW 7 43969327 missense probably damaging 1.00
R5567:Klk1b1 UTSW 7 43971169 missense probably damaging 0.99
R6191:Klk1b1 UTSW 7 43970657 missense probably damaging 1.00
R7162:Klk1b1 UTSW 7 43969247 missense probably damaging 0.99
R7752:Klk1b1 UTSW 7 43971245 missense probably damaging 1.00
X0012:Klk1b1 UTSW 7 43970659 missense probably benign 0.05
Z1088:Klk1b1 UTSW 7 43970401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACAGACCTGTCCTAGCTGC -3'
(R):5'- CAGGTATAATGCTGCCCCAG -3'

Sequencing Primer
(F):5'- TGAGCAGCTCTCAGGTCTG -3'
(R):5'- GATGGGCTTCACAACATCT -3'
Posted On2019-10-17