Incidental Mutation 'R7535:Rbbp6'
ID583516
Institutional Source Beutler Lab
Gene Symbol Rbbp6
Ensembl Gene ENSMUSG00000030779
Gene Nameretinoblastoma binding protein 6, ubiquitin ligase
SynonymsC030034J04Rik, 4933422O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location122965686-123002557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122990143 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 351 (M351I)
Ref Sequence ENSEMBL: ENSMUSP00000049528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052135] [ENSMUST00000071590] [ENSMUST00000231323]
Predicted Effect probably benign
Transcript: ENSMUST00000052135
AA Change: M351I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000049528
Gene: ENSMUSG00000030779
AA Change: M351I

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
coiled coil region 653 679 N/A INTRINSIC
low complexity region 680 774 N/A INTRINSIC
low complexity region 824 844 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
internal_repeat_2 1026 1091 4.38e-6 PROSPERO
internal_repeat_1 1038 1107 3.76e-7 PROSPERO
low complexity region 1120 1141 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1247 1258 N/A INTRINSIC
internal_repeat_2 1395 1466 4.38e-6 PROSPERO
low complexity region 1472 1490 N/A INTRINSIC
internal_repeat_1 1523 1586 3.76e-7 PROSPERO
low complexity region 1689 1752 N/A INTRINSIC
low complexity region 1758 1784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071590
AA Change: M351I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000071519
Gene: ENSMUSG00000030779
AA Change: M351I

DomainStartEndE-ValueType
DWNN 4 76 3.92e-42 SMART
low complexity region 101 110 N/A INTRINSIC
ZnF_C2HC 161 177 5.67e-5 SMART
low complexity region 233 259 N/A INTRINSIC
RING 260 300 6.05e-4 SMART
low complexity region 338 349 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 551 610 N/A INTRINSIC
low complexity region 653 740 N/A INTRINSIC
low complexity region 790 810 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
low complexity region 969 991 N/A INTRINSIC
internal_repeat_2 992 1057 5.65e-6 PROSPERO
internal_repeat_1 1004 1073 5.01e-7 PROSPERO
low complexity region 1086 1107 N/A INTRINSIC
low complexity region 1109 1120 N/A INTRINSIC
low complexity region 1213 1224 N/A INTRINSIC
internal_repeat_2 1361 1432 5.65e-6 PROSPERO
low complexity region 1438 1456 N/A INTRINSIC
internal_repeat_1 1489 1552 5.01e-7 PROSPERO
low complexity region 1655 1718 N/A INTRINSIC
low complexity region 1724 1750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231323
AA Change: M389I

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality, reduced size, growth retardation and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Rbbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Rbbp6 APN 7 122988685 missense probably damaging 1.00
IGL00561:Rbbp6 APN 7 122971063 missense probably damaging 1.00
IGL01144:Rbbp6 APN 7 122975946 missense possibly damaging 0.95
IGL01325:Rbbp6 APN 7 122988618 missense probably damaging 1.00
IGL01520:Rbbp6 APN 7 122985675 missense possibly damaging 0.93
IGL01765:Rbbp6 APN 7 122999954 unclassified probably benign
IGL01985:Rbbp6 APN 7 122971073 missense probably damaging 1.00
IGL02094:Rbbp6 APN 7 122997262 missense probably damaging 1.00
IGL02125:Rbbp6 APN 7 122971129 critical splice donor site probably null
IGL02552:Rbbp6 APN 7 122982981 missense probably damaging 0.98
IGL02805:Rbbp6 APN 7 123001188 utr 3 prime probably benign
changeling UTSW 7 122997311 splice site probably null
Puzzlewit UTSW 7 122999808 unclassified probably benign
R0403:Rbbp6 UTSW 7 122992296 missense probably damaging 0.99
R0855:Rbbp6 UTSW 7 122992248 missense probably benign 0.22
R1132:Rbbp6 UTSW 7 123000113 unclassified probably benign
R1463:Rbbp6 UTSW 7 122992453 missense possibly damaging 0.89
R1867:Rbbp6 UTSW 7 122997029 missense probably damaging 1.00
R1957:Rbbp6 UTSW 7 122990288 missense probably benign 0.04
R1958:Rbbp6 UTSW 7 123001945 unclassified probably benign
R1978:Rbbp6 UTSW 7 122999488 unclassified probably benign
R1999:Rbbp6 UTSW 7 122990352 missense probably damaging 0.98
R2164:Rbbp6 UTSW 7 122999474 unclassified probably benign
R4181:Rbbp6 UTSW 7 122994735 missense probably damaging 0.99
R4387:Rbbp6 UTSW 7 122997311 splice site probably null
R4583:Rbbp6 UTSW 7 123001952 unclassified probably benign
R4936:Rbbp6 UTSW 7 122999703 unclassified probably benign
R4974:Rbbp6 UTSW 7 122999808 unclassified probably benign
R4998:Rbbp6 UTSW 7 122990326 missense probably benign 0.36
R5082:Rbbp6 UTSW 7 123000702 utr 3 prime probably benign
R5502:Rbbp6 UTSW 7 122988724 missense probably damaging 1.00
R5567:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5570:Rbbp6 UTSW 7 123001834 utr 3 prime probably benign
R5607:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5608:Rbbp6 UTSW 7 122997086 missense probably damaging 1.00
R5948:Rbbp6 UTSW 7 122997628 missense probably damaging 1.00
R6134:Rbbp6 UTSW 7 122997311 splice site probably null
R6172:Rbbp6 UTSW 7 122998555 nonsense probably null
R6773:Rbbp6 UTSW 7 122999355 unclassified probably benign
R6800:Rbbp6 UTSW 7 122985064 missense possibly damaging 0.93
R7266:Rbbp6 UTSW 7 123001367 missense unknown
R7298:Rbbp6 UTSW 7 123001194 missense unknown
R7635:Rbbp6 UTSW 7 122976008 missense possibly damaging 0.80
R7665:Rbbp6 UTSW 7 122994686 missense possibly damaging 0.81
R7665:Rbbp6 UTSW 7 122990032 splice site probably null
R7910:Rbbp6 UTSW 7 122997028 missense possibly damaging 0.48
R7956:Rbbp6 UTSW 7 123001338 missense unknown
R8043:Rbbp6 UTSW 7 122985245 missense probably damaging 1.00
R8273:Rbbp6 UTSW 7 122990324 missense probably benign 0.36
R8473:Rbbp6 UTSW 7 123001198 utr 3 prime probably benign
X0062:Rbbp6 UTSW 7 123000146 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGATGCTTTAATTGCCAAC -3'
(R):5'- TGGGGCAGAAGATGGATTTCC -3'

Sequencing Primer
(F):5'- GCCAACAAGTTTTTACGACAGG -3'
(R):5'- TTTCCAGACACAGAAGGAGC -3'
Posted On2019-10-17