Incidental Mutation 'R7535:Irf7'
ID583517
Institutional Source Beutler Lab
Gene Symbol Irf7
Ensembl Gene ENSMUSG00000025498
Gene Nameinterferon regulatory factor 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141262706-141266481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141264637 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 158 (F158I)
Ref Sequence ENSEMBL: ENSMUSP00000026571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026571] [ENSMUST00000080654] [ENSMUST00000097952] [ENSMUST00000106023] [ENSMUST00000106027] [ENSMUST00000122143] [ENSMUST00000155123] [ENSMUST00000167263] [ENSMUST00000209899] [ENSMUST00000210773]
PDB Structure
Crystal structure of IRF-7 DBD apo form [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026571
AA Change: F158I

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026571
Gene: ENSMUSG00000025498
AA Change: F158I

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 240 420 1.38e-63 SMART
low complexity region 425 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080654
SMART Domains Protein: ENSMUSP00000079484
Gene: ENSMUSG00000025497

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 3e-24 BLAST
transmembrane domain 478 500 N/A INTRINSIC
low complexity region 546 580 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097952
AA Change: F158I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095565
Gene: ENSMUSG00000025498
AA Change: F158I

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 209 389 1.38e-63 SMART
low complexity region 394 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106023
SMART Domains Protein: ENSMUSP00000101644
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 208 388 1.38e-63 SMART
low complexity region 393 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106027
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122143
SMART Domains Protein: ENSMUSP00000113195
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
C1 14 70 7.05e-2 SMART
PHD 28 74 1.77e-14 SMART
low complexity region 173 210 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
low complexity region 672 698 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 892 931 N/A INTRINSIC
low complexity region 935 992 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1086 1102 N/A INTRINSIC
low complexity region 1129 1147 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
low complexity region 1200 1217 N/A INTRINSIC
low complexity region 1267 1282 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
Blast:IG_like 1434 1477 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123525
SMART Domains Protein: ENSMUSP00000121026
Gene: ENSMUSG00000025498

DomainStartEndE-ValueType
IRF 1 69 6.35e-3 SMART
IRF-3 77 251 2.62e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130687
SMART Domains Protein: ENSMUSP00000123351
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
Blast:IG_like 242 285 5e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142572
SMART Domains Protein: ENSMUSP00000117393
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
low complexity region 75 96 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 127 166 N/A INTRINSIC
low complexity region 170 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 384 395 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 666 683 N/A INTRINSIC
Blast:IG_like 684 727 3e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155123
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167263
SMART Domains Protein: ENSMUSP00000127292
Gene: ENSMUSG00000025497

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 1e-24 BLAST
low complexity region 462 476 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
transmembrane domain 640 662 N/A INTRINSIC
low complexity region 708 742 N/A INTRINSIC
low complexity region 796 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209899
Predicted Effect probably benign
Transcript: ENSMUST00000210773
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRF7 encodes interferon regulatory factor 7, a member of the interferon regulatory transcription factor (IRF) family. IRF7 has been shown to play a role in the transcriptional activation of virus-inducible cellular genes, including interferon beta chain genes. Inducible expression of IRF7 is largely restricted to lymphoid tissue. Multiple IRF7 transcript variants have been identified, although the functional consequences of these have not yet been established. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are more vulnerable to viral infection and exhibit decreased serum interferon levels in response to viral infection. [provided by MGI curators]
Allele List at MGI

4 alleles

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Irf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Irf7 APN 7 141264640 missense probably benign 0.02
IGL03275:Irf7 APN 7 141265146 missense probably damaging 0.99
Houstonian UTSW 7 141264022 missense probably damaging 0.99
inept UTSW 7 141265140 missense probably damaging 1.00
R0593:Irf7 UTSW 7 141265062 unclassified probably benign
R1339:Irf7 UTSW 7 141263704 missense probably damaging 1.00
R1442:Irf7 UTSW 7 141264022 missense probably damaging 0.99
R4354:Irf7 UTSW 7 141265270 missense probably damaging 1.00
R4724:Irf7 UTSW 7 141264735 missense possibly damaging 0.92
R5444:Irf7 UTSW 7 141264819 unclassified probably benign
R5795:Irf7 UTSW 7 141265116 missense probably damaging 1.00
R7444:Irf7 UTSW 7 141263686 missense probably damaging 1.00
R8357:Irf7 UTSW 7 141263281 missense possibly damaging 0.89
R8457:Irf7 UTSW 7 141263281 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGGTGTTCTCTAGCTTAGCC -3'
(R):5'- AGAACTTTTGGAACTGCTTGGG -3'

Sequencing Primer
(F):5'- CCCAGCTCTGTAACAGTAACTG -3'
(R):5'- TGCTTGGGCATCGTAACCAAATC -3'
Posted On2019-10-17