Incidental Mutation 'R7535:Ddx25'
ID 583523
Institutional Source Beutler Lab
Gene Symbol Ddx25
Ensembl Gene ENSMUSG00000032101
Gene Name DEAD box helicase 25
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 25, GRTH
MMRRC Submission 045607-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R7535 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 35453144-35469766 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35454951 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 446 (F446L)
Ref Sequence ENSEMBL: ENSMUSP00000034612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034612]
AlphaFold Q9QY15
Predicted Effect possibly damaging
Transcript: ENSMUST00000034612
AA Change: F446L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034612
Gene: ENSMUSG00000032101
AA Change: F446L

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 101 111 N/A INTRINSIC
DEXDc 117 316 1.26e-41 SMART
HELICc 353 440 6.18e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The encoded protein is a gonadotropin-regulated and developmentally expressed testicular RNA helicase. It may serve to maintain testicular functions related to steroidogenesis and spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility, arrest of spermatogenesis at step 8, abnormal Leydig cells, and increased germ cell apoptosis in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,837,463 (GRCm39) L449Q probably benign Het
Agtpbp1 T C 13: 59,652,067 (GRCm39) T415A probably benign Het
Akt3 A T 1: 176,924,600 (GRCm39) V165D probably damaging Het
Cbr2 T A 11: 120,620,628 (GRCm39) I219F probably damaging Het
Cdh20 T A 1: 104,902,768 (GRCm39) D486E probably damaging Het
Cenpe A G 3: 134,949,523 (GRCm39) S103G possibly damaging Het
Chd4 T A 6: 125,105,836 (GRCm39) S1818T probably benign Het
Chst5 T C 8: 112,616,795 (GRCm39) D275G probably damaging Het
Clca3a1 A G 3: 144,724,328 (GRCm39) I244T probably damaging Het
Cyp2c54 A G 19: 40,058,716 (GRCm39) Y239H probably benign Het
Czib T G 4: 107,752,097 (GRCm39) S159A probably benign Het
Dgkb T C 12: 38,186,646 (GRCm39) L265P probably damaging Het
Dis3 A G 14: 99,327,415 (GRCm39) S363P probably benign Het
Disp3 T C 4: 148,327,323 (GRCm39) E1187G probably damaging Het
Dop1b G A 16: 93,603,249 (GRCm39) G2061R probably damaging Het
Dsp T C 13: 38,376,765 (GRCm39) S1517P probably benign Het
Epg5 T A 18: 78,076,141 (GRCm39) V2513E probably benign Het
Fryl T A 5: 73,255,539 (GRCm39) T831S probably benign Het
Gm6309 A T 5: 146,105,100 (GRCm39) V271D probably damaging Het
H2-M2 G T 17: 37,793,528 (GRCm39) S159R probably benign Het
Helq A G 5: 100,937,999 (GRCm39) probably null Het
Herc1 G C 9: 66,382,135 (GRCm39) D3621H probably damaging Het
Hsd11b2 A T 8: 106,245,755 (GRCm39) I87F probably damaging Het
Ice2 A G 9: 69,339,360 (GRCm39) N959S probably damaging Het
Ifi47 T A 11: 48,987,452 (GRCm39) D406E probably damaging Het
Ifit3 T G 19: 34,565,280 (GRCm39) S275R probably damaging Het
Insl5 C A 4: 102,875,395 (GRCm39) K118N probably damaging Het
Irf7 A T 7: 140,844,550 (GRCm39) F158I probably benign Het
Kat2b T C 17: 53,931,431 (GRCm39) L143P probably damaging Het
Klk1b1 A T 7: 43,619,746 (GRCm39) N102Y probably damaging Het
Krt13 C T 11: 100,008,824 (GRCm39) G410S unknown Het
Larp6 A T 9: 60,631,437 (GRCm39) T70S probably benign Het
Lrrc37a T C 11: 103,392,683 (GRCm39) E914G possibly damaging Het
Mindy4 T C 6: 55,274,738 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myom2 A G 8: 15,167,679 (GRCm39) Y1088C probably damaging Het
Mysm1 T C 4: 94,840,452 (GRCm39) N655D probably benign Het
Nbas T A 12: 13,329,390 (GRCm39) S112T probably damaging Het
Neb A G 2: 52,055,115 (GRCm39) probably null Het
Noxred1 G A 12: 87,280,206 (GRCm39) A42V probably benign Het
Olfm5 G A 7: 103,803,444 (GRCm39) P340S possibly damaging Het
Or11h4 G A 14: 50,974,122 (GRCm39) P166S probably benign Het
Or2l5 T C 16: 19,333,544 (GRCm39) T281A probably damaging Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Or5m8 T A 2: 85,822,245 (GRCm39) V28E probably benign Het
Or9i1b A G 19: 13,896,449 (GRCm39) K22E probably benign Het
Pccb A T 9: 100,876,615 (GRCm39) probably null Het
Pnn T A 12: 59,118,923 (GRCm39) V502E probably benign Het
Pole2 A T 12: 69,269,203 (GRCm39) I98K probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rasgrp4 A G 7: 28,838,484 (GRCm39) K111E probably benign Het
Rbbp6 G A 7: 122,589,366 (GRCm39) M351I probably benign Het
Rgs19 T G 2: 181,333,101 (GRCm39) H53P probably damaging Het
Rin1 A T 19: 5,102,564 (GRCm39) T369S probably benign Het
Rnaset2b G A 17: 7,259,138 (GRCm39) E135K possibly damaging Het
Rprd2 G A 3: 95,683,899 (GRCm39) P379S probably damaging Het
Sbno1 A G 5: 124,551,342 (GRCm39) L47P possibly damaging Het
Slamf6 T A 1: 171,747,325 (GRCm39) L29Q unknown Het
Slc16a14 T C 1: 84,890,843 (GRCm39) Y154C probably damaging Het
Slc22a29 A G 19: 8,147,342 (GRCm39) F340S probably damaging Het
Slc6a4 T G 11: 76,905,976 (GRCm39) I259S possibly damaging Het
Smarca4 G A 9: 21,558,921 (GRCm39) V651I possibly damaging Het
Susd5 C T 9: 113,893,108 (GRCm39) A62V possibly damaging Het
Syt1 T A 10: 108,463,283 (GRCm39) probably null Het
Taf10 T C 7: 105,390,117 (GRCm39) I218T probably benign Het
Tas1r1 C A 4: 152,112,819 (GRCm39) V745F probably benign Het
Tas2r125 C A 6: 132,887,287 (GRCm39) T225K probably damaging Het
Tcp11l2 G T 10: 84,430,523 (GRCm39) R216L possibly damaging Het
Tnks1bp1 C T 2: 84,893,624 (GRCm39) Q1184* probably null Het
Treml2 T A 17: 48,609,847 (GRCm39) V93D probably damaging Het
Trim11 G A 11: 58,872,891 (GRCm39) E192K probably damaging Het
Trim43a A G 9: 88,470,201 (GRCm39) K336E probably damaging Het
Tspan33 T A 6: 29,717,588 (GRCm39) I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 (GRCm39) C458Y probably damaging Het
Ttc6 A G 12: 57,623,305 (GRCm39) S235G probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Usp36 A T 11: 118,152,872 (GRCm39) S1084T possibly damaging Het
Vps39 T A 2: 120,155,176 (GRCm39) N550I probably damaging Het
Wdr47 A G 3: 108,537,027 (GRCm39) I572V probably benign Het
Zfp112 A T 7: 23,826,135 (GRCm39) Y705F probably damaging Het
Zfp282 A G 6: 47,881,878 (GRCm39) T522A probably benign Het
Zfp292 T C 4: 34,811,487 (GRCm39) D524G probably benign Het
Zfp90 A T 8: 107,150,900 (GRCm39) K204N possibly damaging Het
Zmym2 T C 14: 57,194,536 (GRCm39) S1265P probably damaging Het
Other mutations in Ddx25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ddx25 APN 9 35,454,891 (GRCm39) splice site probably benign
IGL00951:Ddx25 APN 9 35,464,131 (GRCm39) critical splice donor site probably null
IGL02237:Ddx25 APN 9 35,453,365 (GRCm39) splice site probably benign
IGL02270:Ddx25 APN 9 35,465,708 (GRCm39) splice site probably benign
IGL02273:Ddx25 APN 9 35,458,122 (GRCm39) missense possibly damaging 0.95
IGL02325:Ddx25 APN 9 35,465,804 (GRCm39) unclassified probably benign
IGL02422:Ddx25 APN 9 35,462,660 (GRCm39) missense probably null 1.00
IGL02440:Ddx25 APN 9 35,468,974 (GRCm39) unclassified probably benign
IGL02798:Ddx25 APN 9 35,462,693 (GRCm39) missense probably damaging 1.00
IGL03339:Ddx25 APN 9 35,453,299 (GRCm39) missense probably damaging 1.00
R0633:Ddx25 UTSW 9 35,457,268 (GRCm39) missense probably damaging 0.99
R0893:Ddx25 UTSW 9 35,465,686 (GRCm39) nonsense probably null
R1171:Ddx25 UTSW 9 35,458,142 (GRCm39) nonsense probably null
R1448:Ddx25 UTSW 9 35,469,034 (GRCm39) missense probably benign
R1453:Ddx25 UTSW 9 35,453,298 (GRCm39) missense probably damaging 1.00
R1582:Ddx25 UTSW 9 35,457,272 (GRCm39) missense probably damaging 0.97
R3055:Ddx25 UTSW 9 35,462,647 (GRCm39) missense probably damaging 1.00
R5960:Ddx25 UTSW 9 35,465,807 (GRCm39) splice site probably null
R7425:Ddx25 UTSW 9 35,465,882 (GRCm39) missense probably benign 0.08
R7610:Ddx25 UTSW 9 35,465,893 (GRCm39) missense possibly damaging 0.90
R8758:Ddx25 UTSW 9 35,453,300 (GRCm39) missense probably benign
R8931:Ddx25 UTSW 9 35,465,864 (GRCm39) missense possibly damaging 0.85
R8984:Ddx25 UTSW 9 35,468,685 (GRCm39) missense probably benign
R9103:Ddx25 UTSW 9 35,458,085 (GRCm39) missense probably benign 0.24
R9585:Ddx25 UTSW 9 35,455,009 (GRCm39) nonsense probably null
R9759:Ddx25 UTSW 9 35,457,265 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCTTGGCCTATGTTATGAC -3'
(R):5'- CCTTTGGCAAATACAGTTCTTGG -3'

Sequencing Primer
(F):5'- GACTTGGATCCTATGAATTAGAAGC -3'
(R):5'- TTTGTCCTGAAGGAGACATTGTAAG -3'
Posted On 2019-10-17