Incidental Mutation 'R7535:Abca7'
ID 583529
Institutional Source Beutler Lab
Gene Symbol Abca7
Ensembl Gene ENSMUSG00000035722
Gene Name ATP-binding cassette, sub-family A member 7
Synonyms Abc51
MMRRC Submission 045607-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7535 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 79832328-79851406 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79837463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 449 (L449Q)
Ref Sequence ENSEMBL: ENSMUSP00000128121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]
AlphaFold Q91V24
Predicted Effect probably benign
Transcript: ENSMUST00000043866
AA Change: L449Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: L449Q

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132517
AA Change: L449Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: L449Q

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171637
AA Change: L449Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: L449Q

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T C 13: 59,652,067 (GRCm39) T415A probably benign Het
Akt3 A T 1: 176,924,600 (GRCm39) V165D probably damaging Het
Cbr2 T A 11: 120,620,628 (GRCm39) I219F probably damaging Het
Cdh20 T A 1: 104,902,768 (GRCm39) D486E probably damaging Het
Cenpe A G 3: 134,949,523 (GRCm39) S103G possibly damaging Het
Chd4 T A 6: 125,105,836 (GRCm39) S1818T probably benign Het
Chst5 T C 8: 112,616,795 (GRCm39) D275G probably damaging Het
Clca3a1 A G 3: 144,724,328 (GRCm39) I244T probably damaging Het
Cyp2c54 A G 19: 40,058,716 (GRCm39) Y239H probably benign Het
Czib T G 4: 107,752,097 (GRCm39) S159A probably benign Het
Ddx25 A G 9: 35,454,951 (GRCm39) F446L possibly damaging Het
Dgkb T C 12: 38,186,646 (GRCm39) L265P probably damaging Het
Dis3 A G 14: 99,327,415 (GRCm39) S363P probably benign Het
Disp3 T C 4: 148,327,323 (GRCm39) E1187G probably damaging Het
Dop1b G A 16: 93,603,249 (GRCm39) G2061R probably damaging Het
Dsp T C 13: 38,376,765 (GRCm39) S1517P probably benign Het
Epg5 T A 18: 78,076,141 (GRCm39) V2513E probably benign Het
Fryl T A 5: 73,255,539 (GRCm39) T831S probably benign Het
Gm6309 A T 5: 146,105,100 (GRCm39) V271D probably damaging Het
H2-M2 G T 17: 37,793,528 (GRCm39) S159R probably benign Het
Helq A G 5: 100,937,999 (GRCm39) probably null Het
Herc1 G C 9: 66,382,135 (GRCm39) D3621H probably damaging Het
Hsd11b2 A T 8: 106,245,755 (GRCm39) I87F probably damaging Het
Ice2 A G 9: 69,339,360 (GRCm39) N959S probably damaging Het
Ifi47 T A 11: 48,987,452 (GRCm39) D406E probably damaging Het
Ifit3 T G 19: 34,565,280 (GRCm39) S275R probably damaging Het
Insl5 C A 4: 102,875,395 (GRCm39) K118N probably damaging Het
Irf7 A T 7: 140,844,550 (GRCm39) F158I probably benign Het
Kat2b T C 17: 53,931,431 (GRCm39) L143P probably damaging Het
Klk1b1 A T 7: 43,619,746 (GRCm39) N102Y probably damaging Het
Krt13 C T 11: 100,008,824 (GRCm39) G410S unknown Het
Larp6 A T 9: 60,631,437 (GRCm39) T70S probably benign Het
Lrrc37a T C 11: 103,392,683 (GRCm39) E914G possibly damaging Het
Mindy4 T C 6: 55,274,738 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myom2 A G 8: 15,167,679 (GRCm39) Y1088C probably damaging Het
Mysm1 T C 4: 94,840,452 (GRCm39) N655D probably benign Het
Nbas T A 12: 13,329,390 (GRCm39) S112T probably damaging Het
Neb A G 2: 52,055,115 (GRCm39) probably null Het
Noxred1 G A 12: 87,280,206 (GRCm39) A42V probably benign Het
Olfm5 G A 7: 103,803,444 (GRCm39) P340S possibly damaging Het
Or11h4 G A 14: 50,974,122 (GRCm39) P166S probably benign Het
Or2l5 T C 16: 19,333,544 (GRCm39) T281A probably damaging Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Or5m8 T A 2: 85,822,245 (GRCm39) V28E probably benign Het
Or9i1b A G 19: 13,896,449 (GRCm39) K22E probably benign Het
Pccb A T 9: 100,876,615 (GRCm39) probably null Het
Pnn T A 12: 59,118,923 (GRCm39) V502E probably benign Het
Pole2 A T 12: 69,269,203 (GRCm39) I98K probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rasgrp4 A G 7: 28,838,484 (GRCm39) K111E probably benign Het
Rbbp6 G A 7: 122,589,366 (GRCm39) M351I probably benign Het
Rgs19 T G 2: 181,333,101 (GRCm39) H53P probably damaging Het
Rin1 A T 19: 5,102,564 (GRCm39) T369S probably benign Het
Rnaset2b G A 17: 7,259,138 (GRCm39) E135K possibly damaging Het
Rprd2 G A 3: 95,683,899 (GRCm39) P379S probably damaging Het
Sbno1 A G 5: 124,551,342 (GRCm39) L47P possibly damaging Het
Slamf6 T A 1: 171,747,325 (GRCm39) L29Q unknown Het
Slc16a14 T C 1: 84,890,843 (GRCm39) Y154C probably damaging Het
Slc22a29 A G 19: 8,147,342 (GRCm39) F340S probably damaging Het
Slc6a4 T G 11: 76,905,976 (GRCm39) I259S possibly damaging Het
Smarca4 G A 9: 21,558,921 (GRCm39) V651I possibly damaging Het
Susd5 C T 9: 113,893,108 (GRCm39) A62V possibly damaging Het
Syt1 T A 10: 108,463,283 (GRCm39) probably null Het
Taf10 T C 7: 105,390,117 (GRCm39) I218T probably benign Het
Tas1r1 C A 4: 152,112,819 (GRCm39) V745F probably benign Het
Tas2r125 C A 6: 132,887,287 (GRCm39) T225K probably damaging Het
Tcp11l2 G T 10: 84,430,523 (GRCm39) R216L possibly damaging Het
Tnks1bp1 C T 2: 84,893,624 (GRCm39) Q1184* probably null Het
Treml2 T A 17: 48,609,847 (GRCm39) V93D probably damaging Het
Trim11 G A 11: 58,872,891 (GRCm39) E192K probably damaging Het
Trim43a A G 9: 88,470,201 (GRCm39) K336E probably damaging Het
Tspan33 T A 6: 29,717,588 (GRCm39) I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 (GRCm39) C458Y probably damaging Het
Ttc6 A G 12: 57,623,305 (GRCm39) S235G probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Usp36 A T 11: 118,152,872 (GRCm39) S1084T possibly damaging Het
Vps39 T A 2: 120,155,176 (GRCm39) N550I probably damaging Het
Wdr47 A G 3: 108,537,027 (GRCm39) I572V probably benign Het
Zfp112 A T 7: 23,826,135 (GRCm39) Y705F probably damaging Het
Zfp282 A G 6: 47,881,878 (GRCm39) T522A probably benign Het
Zfp292 T C 4: 34,811,487 (GRCm39) D524G probably benign Het
Zfp90 A T 8: 107,150,900 (GRCm39) K204N possibly damaging Het
Zmym2 T C 14: 57,194,536 (GRCm39) S1265P probably damaging Het
Other mutations in Abca7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Abca7 APN 10 79,847,131 (GRCm39) missense probably damaging 0.96
IGL01074:Abca7 APN 10 79,849,726 (GRCm39) missense possibly damaging 0.88
IGL01313:Abca7 APN 10 79,838,957 (GRCm39) splice site probably benign
IGL01372:Abca7 APN 10 79,842,089 (GRCm39) missense probably benign 0.00
IGL01387:Abca7 APN 10 79,835,596 (GRCm39) missense possibly damaging 0.71
IGL01468:Abca7 APN 10 79,839,711 (GRCm39) missense probably benign 0.21
IGL01648:Abca7 APN 10 79,846,914 (GRCm39) missense probably damaging 1.00
IGL01796:Abca7 APN 10 79,849,743 (GRCm39) missense probably damaging 0.99
IGL01977:Abca7 APN 10 79,841,986 (GRCm39) missense probably benign 0.31
IGL01982:Abca7 APN 10 79,838,475 (GRCm39) missense probably damaging 1.00
IGL02115:Abca7 APN 10 79,833,913 (GRCm39) missense probably damaging 1.00
IGL02437:Abca7 APN 10 79,844,223 (GRCm39) missense probably damaging 1.00
IGL02721:Abca7 APN 10 79,849,469 (GRCm39) missense possibly damaging 0.93
IGL02812:Abca7 APN 10 79,841,881 (GRCm39) missense possibly damaging 0.84
IGL02823:Abca7 APN 10 79,844,656 (GRCm39) missense probably damaging 1.00
IGL02827:Abca7 APN 10 79,845,699 (GRCm39) missense probably damaging 1.00
IGL02897:Abca7 APN 10 79,837,426 (GRCm39) missense probably damaging 1.00
IGL02952:Abca7 APN 10 79,843,242 (GRCm39) missense probably damaging 1.00
R0507:Abca7 UTSW 10 79,838,655 (GRCm39) splice site probably benign
R0528:Abca7 UTSW 10 79,838,848 (GRCm39) missense probably damaging 1.00
R0541:Abca7 UTSW 10 79,843,185 (GRCm39) missense probably benign 0.01
R0584:Abca7 UTSW 10 79,847,564 (GRCm39) missense probably damaging 1.00
R1018:Abca7 UTSW 10 79,837,325 (GRCm39) missense probably damaging 1.00
R1099:Abca7 UTSW 10 79,849,577 (GRCm39) nonsense probably null
R1520:Abca7 UTSW 10 79,844,664 (GRCm39) missense possibly damaging 0.69
R1536:Abca7 UTSW 10 79,850,064 (GRCm39) missense probably benign 0.39
R1619:Abca7 UTSW 10 79,844,889 (GRCm39) missense probably damaging 1.00
R1636:Abca7 UTSW 10 79,844,832 (GRCm39) missense probably benign
R1752:Abca7 UTSW 10 79,842,468 (GRCm39) missense probably benign 0.17
R1762:Abca7 UTSW 10 79,835,599 (GRCm39) missense probably damaging 1.00
R1764:Abca7 UTSW 10 79,844,784 (GRCm39) missense probably damaging 1.00
R1891:Abca7 UTSW 10 79,840,874 (GRCm39) missense possibly damaging 0.72
R1911:Abca7 UTSW 10 79,842,468 (GRCm39) missense probably benign 0.17
R2032:Abca7 UTSW 10 79,844,071 (GRCm39) missense probably damaging 1.00
R2188:Abca7 UTSW 10 79,838,367 (GRCm39) missense probably damaging 1.00
R2973:Abca7 UTSW 10 79,844,801 (GRCm39) missense probably damaging 1.00
R2974:Abca7 UTSW 10 79,844,801 (GRCm39) missense probably damaging 1.00
R3055:Abca7 UTSW 10 79,835,581 (GRCm39) missense probably damaging 1.00
R4496:Abca7 UTSW 10 79,838,768 (GRCm39) missense probably damaging 1.00
R4570:Abca7 UTSW 10 79,842,528 (GRCm39) missense probably damaging 1.00
R4581:Abca7 UTSW 10 79,842,402 (GRCm39) missense probably benign 0.03
R4588:Abca7 UTSW 10 79,833,701 (GRCm39) splice site probably null
R4628:Abca7 UTSW 10 79,851,022 (GRCm39) critical splice donor site probably null
R4641:Abca7 UTSW 10 79,841,615 (GRCm39) critical splice donor site probably null
R4888:Abca7 UTSW 10 79,838,562 (GRCm39) missense probably damaging 0.97
R4911:Abca7 UTSW 10 79,848,022 (GRCm39) critical splice donor site probably null
R4979:Abca7 UTSW 10 79,840,617 (GRCm39) nonsense probably null
R4997:Abca7 UTSW 10 79,843,154 (GRCm39) missense possibly damaging 0.90
R5147:Abca7 UTSW 10 79,851,149 (GRCm39) missense probably benign 0.02
R5176:Abca7 UTSW 10 79,834,123 (GRCm39) missense probably benign 0.35
R5190:Abca7 UTSW 10 79,835,427 (GRCm39) critical splice donor site probably null
R5358:Abca7 UTSW 10 79,849,165 (GRCm39) missense probably damaging 0.99
R5409:Abca7 UTSW 10 79,850,154 (GRCm39) missense probably damaging 1.00
R5705:Abca7 UTSW 10 79,851,276 (GRCm39) missense probably benign
R6246:Abca7 UTSW 10 79,850,999 (GRCm39) missense probably damaging 1.00
R6256:Abca7 UTSW 10 79,838,456 (GRCm39) missense probably damaging 1.00
R6260:Abca7 UTSW 10 79,844,821 (GRCm39) missense probably damaging 1.00
R6275:Abca7 UTSW 10 79,833,625 (GRCm39) missense probably damaging 1.00
R6277:Abca7 UTSW 10 79,841,992 (GRCm39) missense probably benign 0.04
R6284:Abca7 UTSW 10 79,840,244 (GRCm39) missense probably benign
R6307:Abca7 UTSW 10 79,843,221 (GRCm39) missense probably damaging 1.00
R6451:Abca7 UTSW 10 79,842,733 (GRCm39) missense probably damaging 0.99
R6456:Abca7 UTSW 10 79,850,984 (GRCm39) missense probably null 0.69
R6460:Abca7 UTSW 10 79,844,862 (GRCm39) missense probably benign 0.04
R6560:Abca7 UTSW 10 79,843,230 (GRCm39) missense probably damaging 1.00
R6565:Abca7 UTSW 10 79,847,622 (GRCm39) missense probably damaging 1.00
R6644:Abca7 UTSW 10 79,844,598 (GRCm39) missense probably damaging 0.98
R6814:Abca7 UTSW 10 79,838,833 (GRCm39) missense probably damaging 1.00
R7289:Abca7 UTSW 10 79,845,778 (GRCm39) missense probably damaging 1.00
R7303:Abca7 UTSW 10 79,850,822 (GRCm39) missense probably benign 0.17
R7493:Abca7 UTSW 10 79,837,896 (GRCm39) missense probably damaging 0.96
R7602:Abca7 UTSW 10 79,833,846 (GRCm39) critical splice acceptor site probably null
R7607:Abca7 UTSW 10 79,847,667 (GRCm39) missense probably damaging 1.00
R7647:Abca7 UTSW 10 79,836,656 (GRCm39) missense probably benign 0.00
R7821:Abca7 UTSW 10 79,838,424 (GRCm39) small deletion probably benign
R7863:Abca7 UTSW 10 79,844,655 (GRCm39) missense probably damaging 1.00
R7896:Abca7 UTSW 10 79,840,792 (GRCm39) missense probably damaging 1.00
R7911:Abca7 UTSW 10 79,840,867 (GRCm39) missense probably benign 0.00
R8114:Abca7 UTSW 10 79,844,874 (GRCm39) missense probably damaging 1.00
R8356:Abca7 UTSW 10 79,842,360 (GRCm39) missense probably benign 0.05
R8439:Abca7 UTSW 10 79,841,995 (GRCm39) missense probably benign 0.03
R8456:Abca7 UTSW 10 79,842,360 (GRCm39) missense probably benign 0.05
R8830:Abca7 UTSW 10 79,844,805 (GRCm39) missense probably damaging 1.00
R9004:Abca7 UTSW 10 79,841,483 (GRCm39) missense probably damaging 1.00
R9066:Abca7 UTSW 10 79,849,188 (GRCm39) missense probably damaging 0.98
R9116:Abca7 UTSW 10 79,838,973 (GRCm39) missense
R9128:Abca7 UTSW 10 79,838,352 (GRCm39) missense possibly damaging 0.95
R9141:Abca7 UTSW 10 79,851,264 (GRCm39) missense possibly damaging 0.82
R9184:Abca7 UTSW 10 79,838,690 (GRCm39) missense probably damaging 0.97
R9246:Abca7 UTSW 10 79,838,535 (GRCm39) missense probably damaging 1.00
R9320:Abca7 UTSW 10 79,833,471 (GRCm39) missense possibly damaging 0.55
R9426:Abca7 UTSW 10 79,851,264 (GRCm39) missense possibly damaging 0.82
R9490:Abca7 UTSW 10 79,834,601 (GRCm39) missense probably benign
R9561:Abca7 UTSW 10 79,837,535 (GRCm39) missense probably damaging 1.00
R9672:Abca7 UTSW 10 79,838,563 (GRCm39) missense probably null 1.00
Z1176:Abca7 UTSW 10 79,842,393 (GRCm39) missense probably damaging 1.00
Z1176:Abca7 UTSW 10 79,835,266 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACCTAGGGGTATGAGGAAC -3'
(R):5'- GCCACAACCCCATGTAGTTC -3'

Sequencing Primer
(F):5'- GGGGTTTTAGTCACACCCCAGATC -3'
(R):5'- ACAACCCCATGTAGTTCTATCTATC -3'
Posted On 2019-10-17