Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Abca7'

583529

Institutional Source

Beutler Lab

Gene Symbol

Abca7

Ensembl Gene

ENSMUSG00000035722

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 7

Synonyms

Abc51

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79996494-80015572 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80001629 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 449 (L449Q)

Ref Sequence

ENSEMBL: ENSMUSP00000128121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]

AlphaFold

Q91V24

Predicted Effect

probably benign
Transcript: ENSMUST00000043866
AA Change: L449Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: L449Q

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	515	747	1.1e-17	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1241	1263	N/A	INTRINSIC
low complexity region	1299	1309	N/A	INTRINSIC
low complexity region	1374	1390	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1427	1764	9e-43	PFAM
AAA	1833	2018	7.2e-9	SMART
low complexity region	2120	2135	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132517
AA Change: L449Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: L449Q

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	515	747	1.1e-17	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1241	1263	N/A	INTRINSIC
low complexity region	1299	1309	N/A	INTRINSIC
low complexity region	1374	1390	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1427	1764	9e-43	PFAM
AAA	1833	2018	7.2e-9	SMART
low complexity region	2120	2135	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171637
AA Change: L449Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: L449Q

Domain	Start	End	E-Value	Type
transmembrane domain	23	42	N/A	INTRINSIC
Pfam:ABC2_membrane_3	517	747	2.8e-19	PFAM
AAA	830	1011	4.97e-12	SMART
low complexity region	1136	1147	N/A	INTRINSIC
transmembrane domain	1249	1271	N/A	INTRINSIC
low complexity region	1307	1317	N/A	INTRINSIC
low complexity region	1382	1398	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1426	1772	3.9e-47	PFAM
AAA	1841	2026	7.2e-9	SMART
low complexity region	2128	2143	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Abca7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Abca7	APN	10	80011297	missense	probably damaging	0.96
IGL01074:Abca7	APN	10	80013892	missense	possibly damaging	0.88
IGL01313:Abca7	APN	10	80003123	splice site	probably benign
IGL01372:Abca7	APN	10	80006255	missense	probably benign	0.00
IGL01387:Abca7	APN	10	79999762	missense	possibly damaging	0.71
IGL01468:Abca7	APN	10	80003877	missense	probably benign	0.21
IGL01648:Abca7	APN	10	80011080	missense	probably damaging	1.00
IGL01796:Abca7	APN	10	80013909	missense	probably damaging	0.99
IGL01977:Abca7	APN	10	80006152	missense	probably benign	0.31
IGL01982:Abca7	APN	10	80002641	missense	probably damaging	1.00
IGL02115:Abca7	APN	10	79998079	missense	probably damaging	1.00
IGL02437:Abca7	APN	10	80008389	missense	probably damaging	1.00
IGL02721:Abca7	APN	10	80013635	missense	possibly damaging	0.93
IGL02812:Abca7	APN	10	80006047	missense	possibly damaging	0.84
IGL02823:Abca7	APN	10	80008822	missense	probably damaging	1.00
IGL02827:Abca7	APN	10	80009865	missense	probably damaging	1.00
IGL02897:Abca7	APN	10	80001592	missense	probably damaging	1.00
IGL02952:Abca7	APN	10	80007408	missense	probably damaging	1.00
R0507:Abca7	UTSW	10	80002821	splice site	probably benign
R0528:Abca7	UTSW	10	80003014	missense	probably damaging	1.00
R0541:Abca7	UTSW	10	80007351	missense	probably benign	0.01
R0584:Abca7	UTSW	10	80011730	missense	probably damaging	1.00
R1018:Abca7	UTSW	10	80001491	missense	probably damaging	1.00
R1099:Abca7	UTSW	10	80013743	nonsense	probably null
R1520:Abca7	UTSW	10	80008830	missense	possibly damaging	0.69
R1536:Abca7	UTSW	10	80014230	missense	probably benign	0.39
R1619:Abca7	UTSW	10	80009055	missense	probably damaging	1.00
R1636:Abca7	UTSW	10	80008998	missense	probably benign
R1752:Abca7	UTSW	10	80006634	missense	probably benign	0.17
R1762:Abca7	UTSW	10	79999765	missense	probably damaging	1.00
R1764:Abca7	UTSW	10	80008950	missense	probably damaging	1.00
R1891:Abca7	UTSW	10	80005040	missense	possibly damaging	0.72
R1911:Abca7	UTSW	10	80006634	missense	probably benign	0.17
R2032:Abca7	UTSW	10	80008237	missense	probably damaging	1.00
R2188:Abca7	UTSW	10	80002533	missense	probably damaging	1.00
R2973:Abca7	UTSW	10	80008967	missense	probably damaging	1.00
R2974:Abca7	UTSW	10	80008967	missense	probably damaging	1.00
R3055:Abca7	UTSW	10	79999747	missense	probably damaging	1.00
R4496:Abca7	UTSW	10	80002934	missense	probably damaging	1.00
R4570:Abca7	UTSW	10	80006694	missense	probably damaging	1.00
R4581:Abca7	UTSW	10	80006568	missense	probably benign	0.03
R4588:Abca7	UTSW	10	79997867	splice site	probably null
R4628:Abca7	UTSW	10	80015188	critical splice donor site	probably null
R4641:Abca7	UTSW	10	80005781	critical splice donor site	probably null
R4888:Abca7	UTSW	10	80002728	missense	probably damaging	0.97
R4911:Abca7	UTSW	10	80012188	critical splice donor site	probably null
R4979:Abca7	UTSW	10	80004783	nonsense	probably null
R4997:Abca7	UTSW	10	80007320	missense	possibly damaging	0.90
R5147:Abca7	UTSW	10	80015315	missense	probably benign	0.02
R5176:Abca7	UTSW	10	79998289	missense	probably benign	0.35
R5190:Abca7	UTSW	10	79999593	critical splice donor site	probably null
R5358:Abca7	UTSW	10	80013331	missense	probably damaging	0.99
R5409:Abca7	UTSW	10	80014320	missense	probably damaging	1.00
R5705:Abca7	UTSW	10	80015442	missense	probably benign
R6246:Abca7	UTSW	10	80015165	missense	probably damaging	1.00
R6256:Abca7	UTSW	10	80002622	missense	probably damaging	1.00
R6260:Abca7	UTSW	10	80008987	missense	probably damaging	1.00
R6275:Abca7	UTSW	10	79997791	missense	probably damaging	1.00
R6277:Abca7	UTSW	10	80006158	missense	probably benign	0.04
R6284:Abca7	UTSW	10	80004410	missense	probably benign
R6307:Abca7	UTSW	10	80007387	missense	probably damaging	1.00
R6451:Abca7	UTSW	10	80006899	missense	probably damaging	0.99
R6456:Abca7	UTSW	10	80015150	missense	probably null	0.69
R6460:Abca7	UTSW	10	80009028	missense	probably benign	0.04
R6560:Abca7	UTSW	10	80007396	missense	probably damaging	1.00
R6565:Abca7	UTSW	10	80011788	missense	probably damaging	1.00
R6644:Abca7	UTSW	10	80008764	missense	probably damaging	0.98
R6814:Abca7	UTSW	10	80002999	missense	probably damaging	1.00
R7289:Abca7	UTSW	10	80009944	missense	probably damaging	1.00
R7303:Abca7	UTSW	10	80014988	missense	probably benign	0.17
R7493:Abca7	UTSW	10	80002062	missense	probably damaging	0.96
R7602:Abca7	UTSW	10	79998012	critical splice acceptor site	probably null
R7607:Abca7	UTSW	10	80011833	missense	probably damaging	1.00
R7647:Abca7	UTSW	10	80000822	missense	probably benign	0.00
R7821:Abca7	UTSW	10	80002590	small deletion	probably benign
R7863:Abca7	UTSW	10	80008821	missense	probably damaging	1.00
R7896:Abca7	UTSW	10	80004958	missense	probably damaging	1.00
R7911:Abca7	UTSW	10	80005033	missense	probably benign	0.00
R8114:Abca7	UTSW	10	80009040	missense	probably damaging	1.00
R8356:Abca7	UTSW	10	80006526	missense	probably benign	0.05
R8439:Abca7	UTSW	10	80006161	missense	probably benign	0.03
R8456:Abca7	UTSW	10	80006526	missense	probably benign	0.05
R8830:Abca7	UTSW	10	80008971	missense	probably damaging	1.00
R9004:Abca7	UTSW	10	80005649	missense	probably damaging	1.00
R9066:Abca7	UTSW	10	80013354	missense	probably damaging	0.98
R9116:Abca7	UTSW	10	80003139	missense
R9128:Abca7	UTSW	10	80002518	missense	possibly damaging	0.95
R9141:Abca7	UTSW	10	80015430	missense	possibly damaging	0.82
R9184:Abca7	UTSW	10	80002856	missense	probably damaging	0.97
R9246:Abca7	UTSW	10	80002701	missense	probably damaging	1.00
R9320:Abca7	UTSW	10	79997637	missense	possibly damaging	0.55
R9426:Abca7	UTSW	10	80015430	missense	possibly damaging	0.82
R9490:Abca7	UTSW	10	79998767	missense	probably benign
R9561:Abca7	UTSW	10	80001701	missense	probably damaging	1.00
R9672:Abca7	UTSW	10	80002729	missense	probably null	1.00
Z1176:Abca7	UTSW	10	79999432	nonsense	probably null
Z1176:Abca7	UTSW	10	80006559	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACCTAGGGGTATGAGGAAC -3'
(R):5'- GCCACAACCCCATGTAGTTC -3'

Sequencing Primer
(F):5'- GGGGTTTTAGTCACACCCCAGATC -3'
(R):5'- ACAACCCCATGTAGTTCTATCTATC -3'

Posted On

2019-10-17