Incidental Mutation 'R7535:Abca7'
ID583529
Institutional Source Beutler Lab
Gene Symbol Abca7
Ensembl Gene ENSMUSG00000035722
Gene NameATP-binding cassette, sub-family A (ABC1), member 7
SynonymsAbc51
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79996494-80015572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80001629 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 449 (L449Q)
Ref Sequence ENSEMBL: ENSMUSP00000128121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]
Predicted Effect probably benign
Transcript: ENSMUST00000043866
AA Change: L449Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: L449Q

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132517
AA Change: L449Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: L449Q

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171637
AA Change: L449Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: L449Q

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Abca7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Abca7 APN 10 80011297 missense probably damaging 0.96
IGL01074:Abca7 APN 10 80013892 missense possibly damaging 0.88
IGL01313:Abca7 APN 10 80003123 splice site probably benign
IGL01372:Abca7 APN 10 80006255 missense probably benign 0.00
IGL01387:Abca7 APN 10 79999762 missense possibly damaging 0.71
IGL01468:Abca7 APN 10 80003877 missense probably benign 0.21
IGL01648:Abca7 APN 10 80011080 missense probably damaging 1.00
IGL01796:Abca7 APN 10 80013909 missense probably damaging 0.99
IGL01977:Abca7 APN 10 80006152 missense probably benign 0.31
IGL01982:Abca7 APN 10 80002641 missense probably damaging 1.00
IGL02115:Abca7 APN 10 79998079 missense probably damaging 1.00
IGL02437:Abca7 APN 10 80008389 missense probably damaging 1.00
IGL02721:Abca7 APN 10 80013635 missense possibly damaging 0.93
IGL02812:Abca7 APN 10 80006047 missense possibly damaging 0.84
IGL02823:Abca7 APN 10 80008822 missense probably damaging 1.00
IGL02827:Abca7 APN 10 80009865 missense probably damaging 1.00
IGL02897:Abca7 APN 10 80001592 missense probably damaging 1.00
IGL02952:Abca7 APN 10 80007408 missense probably damaging 1.00
R0507:Abca7 UTSW 10 80002821 splice site probably benign
R0528:Abca7 UTSW 10 80003014 missense probably damaging 1.00
R0541:Abca7 UTSW 10 80007351 missense probably benign 0.01
R0584:Abca7 UTSW 10 80011730 missense probably damaging 1.00
R1018:Abca7 UTSW 10 80001491 missense probably damaging 1.00
R1099:Abca7 UTSW 10 80013743 nonsense probably null
R1520:Abca7 UTSW 10 80008830 missense possibly damaging 0.69
R1536:Abca7 UTSW 10 80014230 missense probably benign 0.39
R1619:Abca7 UTSW 10 80009055 missense probably damaging 1.00
R1636:Abca7 UTSW 10 80008998 missense probably benign
R1752:Abca7 UTSW 10 80006634 missense probably benign 0.17
R1762:Abca7 UTSW 10 79999765 missense probably damaging 1.00
R1764:Abca7 UTSW 10 80008950 missense probably damaging 1.00
R1891:Abca7 UTSW 10 80005040 missense possibly damaging 0.72
R1911:Abca7 UTSW 10 80006634 missense probably benign 0.17
R2032:Abca7 UTSW 10 80008237 missense probably damaging 1.00
R2188:Abca7 UTSW 10 80002533 missense probably damaging 1.00
R2973:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R2974:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R3055:Abca7 UTSW 10 79999747 missense probably damaging 1.00
R4496:Abca7 UTSW 10 80002934 missense probably damaging 1.00
R4570:Abca7 UTSW 10 80006694 missense probably damaging 1.00
R4581:Abca7 UTSW 10 80006568 missense probably benign 0.03
R4588:Abca7 UTSW 10 79997867 splice site probably null
R4628:Abca7 UTSW 10 80015188 critical splice donor site probably null
R4641:Abca7 UTSW 10 80005781 critical splice donor site probably null
R4888:Abca7 UTSW 10 80002728 missense probably damaging 0.97
R4911:Abca7 UTSW 10 80012188 critical splice donor site probably null
R4979:Abca7 UTSW 10 80004783 nonsense probably null
R4997:Abca7 UTSW 10 80007320 missense possibly damaging 0.90
R5147:Abca7 UTSW 10 80015315 missense probably benign 0.02
R5176:Abca7 UTSW 10 79998289 missense probably benign 0.35
R5190:Abca7 UTSW 10 79999593 critical splice donor site probably null
R5358:Abca7 UTSW 10 80013331 missense probably damaging 0.99
R5409:Abca7 UTSW 10 80014320 missense probably damaging 1.00
R5705:Abca7 UTSW 10 80015442 missense probably benign
R6246:Abca7 UTSW 10 80015165 missense probably damaging 1.00
R6256:Abca7 UTSW 10 80002622 missense probably damaging 1.00
R6260:Abca7 UTSW 10 80008987 missense probably damaging 1.00
R6275:Abca7 UTSW 10 79997791 missense probably damaging 1.00
R6277:Abca7 UTSW 10 80006158 missense probably benign 0.04
R6284:Abca7 UTSW 10 80004410 missense probably benign
R6307:Abca7 UTSW 10 80007387 missense probably damaging 1.00
R6451:Abca7 UTSW 10 80006899 missense probably damaging 0.99
R6456:Abca7 UTSW 10 80015150 missense probably null 0.69
R6460:Abca7 UTSW 10 80009028 missense probably benign 0.04
R6560:Abca7 UTSW 10 80007396 missense probably damaging 1.00
R6565:Abca7 UTSW 10 80011788 missense probably damaging 1.00
R6644:Abca7 UTSW 10 80008764 missense probably damaging 0.98
R6814:Abca7 UTSW 10 80002999 missense probably damaging 1.00
R7289:Abca7 UTSW 10 80009944 missense probably damaging 1.00
R7303:Abca7 UTSW 10 80014988 missense probably benign 0.17
R7493:Abca7 UTSW 10 80002062 missense probably damaging 0.96
R7602:Abca7 UTSW 10 79998012 critical splice acceptor site probably null
R7607:Abca7 UTSW 10 80011833 missense probably damaging 1.00
R7647:Abca7 UTSW 10 80000822 missense probably benign 0.00
R7821:Abca7 UTSW 10 80002590 small deletion probably benign
R7863:Abca7 UTSW 10 80008821 missense probably damaging 1.00
R7896:Abca7 UTSW 10 80004958 missense probably damaging 1.00
R7911:Abca7 UTSW 10 80005033 missense probably benign 0.00
R8114:Abca7 UTSW 10 80009040 missense probably damaging 1.00
R8356:Abca7 UTSW 10 80006526 missense probably benign 0.05
R8439:Abca7 UTSW 10 80006161 missense probably benign 0.03
R8456:Abca7 UTSW 10 80006526 missense probably benign 0.05
Z1176:Abca7 UTSW 10 79999432 nonsense probably null
Z1176:Abca7 UTSW 10 80006559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTAGGGGTATGAGGAAC -3'
(R):5'- GCCACAACCCCATGTAGTTC -3'

Sequencing Primer
(F):5'- GGGGTTTTAGTCACACCCCAGATC -3'
(R):5'- ACAACCCCATGTAGTTCTATCTATC -3'
Posted On2019-10-17