Incidental Mutation 'R7535:Ifi47'
ID 583532
Institutional Source Beutler Lab
Gene Symbol Ifi47
Ensembl Gene ENSMUSG00000078920
Gene Name interferon gamma inducible protein 47
Synonyms 47kDa, IRG-47, Igrd, Iigp4
MMRRC Submission 045607-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7535 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 48967414-48987801 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48987452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 406 (D406E)
Ref Sequence ENSEMBL: ENSMUSP00000041975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046704] [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000109202] [ENSMUST00000152914] [ENSMUST00000179282] [ENSMUST00000203149] [ENSMUST00000203810] [ENSMUST00000213728] [ENSMUST00000214804]
AlphaFold Q61635
Predicted Effect probably damaging
Transcript: ENSMUST00000046704
AA Change: D406E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041975
Gene: ENSMUSG00000078920
AA Change: D406E

DomainStartEndE-ValueType
Pfam:IIGP 40 414 1.7e-177 PFAM
Pfam:MMR_HSR1 76 219 9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109202
AA Change: D406E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104825
Gene: ENSMUSG00000078920
AA Change: D406E

DomainStartEndE-ValueType
Pfam:IIGP 40 414 3.1e-175 PFAM
Pfam:Miro 76 191 2.4e-6 PFAM
Pfam:MMR_HSR1 76 211 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152914
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203149
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203810
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213728
AA Change: D406E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214804
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: In the absence of infection, mice show no overt phenotype. Resistance to protozoan parasitic infection is impaired in homozygous mutant mice, whereas resistance to bacterial and viral infection are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,837,463 (GRCm39) L449Q probably benign Het
Agtpbp1 T C 13: 59,652,067 (GRCm39) T415A probably benign Het
Akt3 A T 1: 176,924,600 (GRCm39) V165D probably damaging Het
Cbr2 T A 11: 120,620,628 (GRCm39) I219F probably damaging Het
Cdh20 T A 1: 104,902,768 (GRCm39) D486E probably damaging Het
Cenpe A G 3: 134,949,523 (GRCm39) S103G possibly damaging Het
Chd4 T A 6: 125,105,836 (GRCm39) S1818T probably benign Het
Chst5 T C 8: 112,616,795 (GRCm39) D275G probably damaging Het
Clca3a1 A G 3: 144,724,328 (GRCm39) I244T probably damaging Het
Cyp2c54 A G 19: 40,058,716 (GRCm39) Y239H probably benign Het
Czib T G 4: 107,752,097 (GRCm39) S159A probably benign Het
Ddx25 A G 9: 35,454,951 (GRCm39) F446L possibly damaging Het
Dgkb T C 12: 38,186,646 (GRCm39) L265P probably damaging Het
Dis3 A G 14: 99,327,415 (GRCm39) S363P probably benign Het
Disp3 T C 4: 148,327,323 (GRCm39) E1187G probably damaging Het
Dop1b G A 16: 93,603,249 (GRCm39) G2061R probably damaging Het
Dsp T C 13: 38,376,765 (GRCm39) S1517P probably benign Het
Epg5 T A 18: 78,076,141 (GRCm39) V2513E probably benign Het
Fryl T A 5: 73,255,539 (GRCm39) T831S probably benign Het
Gm6309 A T 5: 146,105,100 (GRCm39) V271D probably damaging Het
H2-M2 G T 17: 37,793,528 (GRCm39) S159R probably benign Het
Helq A G 5: 100,937,999 (GRCm39) probably null Het
Herc1 G C 9: 66,382,135 (GRCm39) D3621H probably damaging Het
Hsd11b2 A T 8: 106,245,755 (GRCm39) I87F probably damaging Het
Ice2 A G 9: 69,339,360 (GRCm39) N959S probably damaging Het
Ifit3 T G 19: 34,565,280 (GRCm39) S275R probably damaging Het
Insl5 C A 4: 102,875,395 (GRCm39) K118N probably damaging Het
Irf7 A T 7: 140,844,550 (GRCm39) F158I probably benign Het
Kat2b T C 17: 53,931,431 (GRCm39) L143P probably damaging Het
Klk1b1 A T 7: 43,619,746 (GRCm39) N102Y probably damaging Het
Krt13 C T 11: 100,008,824 (GRCm39) G410S unknown Het
Larp6 A T 9: 60,631,437 (GRCm39) T70S probably benign Het
Lrrc37a T C 11: 103,392,683 (GRCm39) E914G possibly damaging Het
Mindy4 T C 6: 55,274,738 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myom2 A G 8: 15,167,679 (GRCm39) Y1088C probably damaging Het
Mysm1 T C 4: 94,840,452 (GRCm39) N655D probably benign Het
Nbas T A 12: 13,329,390 (GRCm39) S112T probably damaging Het
Neb A G 2: 52,055,115 (GRCm39) probably null Het
Noxred1 G A 12: 87,280,206 (GRCm39) A42V probably benign Het
Olfm5 G A 7: 103,803,444 (GRCm39) P340S possibly damaging Het
Or11h4 G A 14: 50,974,122 (GRCm39) P166S probably benign Het
Or2l5 T C 16: 19,333,544 (GRCm39) T281A probably damaging Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Or5m8 T A 2: 85,822,245 (GRCm39) V28E probably benign Het
Or9i1b A G 19: 13,896,449 (GRCm39) K22E probably benign Het
Pccb A T 9: 100,876,615 (GRCm39) probably null Het
Pnn T A 12: 59,118,923 (GRCm39) V502E probably benign Het
Pole2 A T 12: 69,269,203 (GRCm39) I98K probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rasgrp4 A G 7: 28,838,484 (GRCm39) K111E probably benign Het
Rbbp6 G A 7: 122,589,366 (GRCm39) M351I probably benign Het
Rgs19 T G 2: 181,333,101 (GRCm39) H53P probably damaging Het
Rin1 A T 19: 5,102,564 (GRCm39) T369S probably benign Het
Rnaset2b G A 17: 7,259,138 (GRCm39) E135K possibly damaging Het
Rprd2 G A 3: 95,683,899 (GRCm39) P379S probably damaging Het
Sbno1 A G 5: 124,551,342 (GRCm39) L47P possibly damaging Het
Slamf6 T A 1: 171,747,325 (GRCm39) L29Q unknown Het
Slc16a14 T C 1: 84,890,843 (GRCm39) Y154C probably damaging Het
Slc22a29 A G 19: 8,147,342 (GRCm39) F340S probably damaging Het
Slc6a4 T G 11: 76,905,976 (GRCm39) I259S possibly damaging Het
Smarca4 G A 9: 21,558,921 (GRCm39) V651I possibly damaging Het
Susd5 C T 9: 113,893,108 (GRCm39) A62V possibly damaging Het
Syt1 T A 10: 108,463,283 (GRCm39) probably null Het
Taf10 T C 7: 105,390,117 (GRCm39) I218T probably benign Het
Tas1r1 C A 4: 152,112,819 (GRCm39) V745F probably benign Het
Tas2r125 C A 6: 132,887,287 (GRCm39) T225K probably damaging Het
Tcp11l2 G T 10: 84,430,523 (GRCm39) R216L possibly damaging Het
Tnks1bp1 C T 2: 84,893,624 (GRCm39) Q1184* probably null Het
Treml2 T A 17: 48,609,847 (GRCm39) V93D probably damaging Het
Trim11 G A 11: 58,872,891 (GRCm39) E192K probably damaging Het
Trim43a A G 9: 88,470,201 (GRCm39) K336E probably damaging Het
Tspan33 T A 6: 29,717,588 (GRCm39) I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 (GRCm39) C458Y probably damaging Het
Ttc6 A G 12: 57,623,305 (GRCm39) S235G probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Usp36 A T 11: 118,152,872 (GRCm39) S1084T possibly damaging Het
Vps39 T A 2: 120,155,176 (GRCm39) N550I probably damaging Het
Wdr47 A G 3: 108,537,027 (GRCm39) I572V probably benign Het
Zfp112 A T 7: 23,826,135 (GRCm39) Y705F probably damaging Het
Zfp282 A G 6: 47,881,878 (GRCm39) T522A probably benign Het
Zfp292 T C 4: 34,811,487 (GRCm39) D524G probably benign Het
Zfp90 A T 8: 107,150,900 (GRCm39) K204N possibly damaging Het
Zmym2 T C 14: 57,194,536 (GRCm39) S1265P probably damaging Het
Other mutations in Ifi47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Ifi47 APN 11 48,986,241 (GRCm39) nonsense probably null
IGL00811:Ifi47 APN 11 48,986,244 (GRCm39) missense probably benign 0.00
IGL02451:Ifi47 APN 11 48,986,604 (GRCm39) missense probably damaging 1.00
IGL02468:Ifi47 APN 11 48,986,810 (GRCm39) missense probably damaging 0.98
IGL02902:Ifi47 APN 11 48,986,617 (GRCm39) missense probably benign 0.00
IGL03260:Ifi47 APN 11 48,986,932 (GRCm39) missense probably damaging 0.99
R0111:Ifi47 UTSW 11 48,986,897 (GRCm39) missense probably damaging 1.00
R0636:Ifi47 UTSW 11 48,987,478 (GRCm39) missense possibly damaging 0.85
R1548:Ifi47 UTSW 11 48,986,698 (GRCm39) missense probably damaging 1.00
R2255:Ifi47 UTSW 11 48,987,474 (GRCm39) missense probably benign 0.02
R3703:Ifi47 UTSW 11 48,986,352 (GRCm39) missense probably benign 0.01
R5071:Ifi47 UTSW 11 48,986,361 (GRCm39) missense probably benign 0.01
R5073:Ifi47 UTSW 11 48,986,361 (GRCm39) missense probably benign 0.01
R5074:Ifi47 UTSW 11 48,986,361 (GRCm39) missense probably benign 0.01
R5262:Ifi47 UTSW 11 48,986,559 (GRCm39) missense probably benign 0.00
R5902:Ifi47 UTSW 11 48,986,213 (GRCm39) splice site probably null
R6745:Ifi47 UTSW 11 48,986,329 (GRCm39) missense probably benign 0.38
R7155:Ifi47 UTSW 11 48,987,369 (GRCm39) missense probably benign 0.39
R8330:Ifi47 UTSW 11 48,986,637 (GRCm39) missense possibly damaging 0.55
R8412:Ifi47 UTSW 11 48,986,425 (GRCm39) missense probably damaging 0.98
R9076:Ifi47 UTSW 11 48,986,842 (GRCm39) missense probably benign
R9487:Ifi47 UTSW 11 48,986,620 (GRCm39) missense probably damaging 1.00
R9747:Ifi47 UTSW 11 48,987,367 (GRCm39) missense possibly damaging 0.93
Z1177:Ifi47 UTSW 11 48,987,102 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCTTGAAGGATTACCGAAGC -3'
(R):5'- GGAAGCAATGGACTTCCTTCATG -3'

Sequencing Primer
(F):5'- GAAGGATTACCGAAGCTATTTTGGC -3'
(R):5'- GCAATGGACTTCCTTCATGGGATAC -3'
Posted On 2019-10-17