Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Nbas'

583539

Institutional Source

Beutler Lab

Gene Symbol

Nbas

Ensembl Gene

ENSMUSG00000020576

Gene Name

neuroblastoma amplified sequence

Synonyms

4933425L03Rik

MMRRC Submission

Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13269133-13583811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 13279389 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 112 (S112T)

Ref Sequence

ENSEMBL: ENSMUSP00000036082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042953]

AlphaFold

E9Q411

Predicted Effect

probably damaging
Transcript: ENSMUST00000042953
AA Change: S112T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: S112T

Domain	Start	End	E-Value	Type
Pfam:Nbas_N	89	370	4.7e-171	PFAM
low complexity region	463	475	N/A	INTRINSIC
low complexity region	653	667	N/A	INTRINSIC
Pfam:Sec39	725	1375	3.8e-34	PFAM
low complexity region	1392	1404	N/A	INTRINSIC
low complexity region	1549	1566	N/A	INTRINSIC
low complexity region	2226	2252	N/A	INTRINSIC
low complexity region	2275	2285	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]

Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Nbas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Nbas	APN	12	13453075	missense	probably benign	0.19
IGL00712:Nbas	APN	12	13362625	splice site	probably benign
IGL00808:Nbas	APN	12	13566120	splice site	probably benign
IGL00915:Nbas	APN	12	13374752	nonsense	probably null
IGL00923:Nbas	APN	12	13336284	missense	possibly damaging	0.46
IGL01152:Nbas	APN	12	13360958	missense	probably damaging	1.00
IGL01633:Nbas	APN	12	13483897	missense	probably damaging	1.00
IGL01672:Nbas	APN	12	13379649	missense	possibly damaging	0.63
IGL01799:Nbas	APN	12	13324400	splice site	probably benign
IGL01812:Nbas	APN	12	13453503	missense	probably damaging	1.00
IGL01934:Nbas	APN	12	13289879	splice site	probably benign
IGL02093:Nbas	APN	12	13560962	missense	probably benign	0.00
IGL02115:Nbas	APN	12	13317692	splice site	probably benign
IGL02175:Nbas	APN	12	13566259	critical splice donor site	probably null
IGL02268:Nbas	APN	12	13405397	missense	possibly damaging	0.94
IGL02483:Nbas	APN	12	13324294	missense	probably damaging	1.00
IGL02539:Nbas	APN	12	13272703	splice site	probably benign
IGL02557:Nbas	APN	12	13361028	missense	probably damaging	1.00
IGL02815:Nbas	APN	12	13310266	missense	probably damaging	1.00
IGL02951:Nbas	APN	12	13362541	missense	probably benign
IGL03131:Nbas	APN	12	13279416	missense	probably benign	0.03
IGL03214:Nbas	APN	12	13331110	splice site	probably benign
IGL03308:Nbas	APN	12	13324348	missense	possibly damaging	0.93
IGL03368:Nbas	APN	12	13328451	missense	probably benign	0.08
IGL03372:Nbas	APN	12	13534472	missense	probably damaging	1.00
IGL03391:Nbas	APN	12	13483749	missense	probably benign	0.28
medvedev	UTSW	12	13534577	critical splice donor site	probably null
oligarchs	UTSW	12	13520750	missense	possibly damaging	0.75
putin	UTSW	12	13321755	missense	probably damaging	1.00
1mM(1):Nbas	UTSW	12	13288728	missense	probably damaging	1.00
R0057:Nbas	UTSW	12	13390957	missense	probably benign	0.00
R0076:Nbas	UTSW	12	13324336	missense	probably damaging	1.00
R0153:Nbas	UTSW	12	13273876	splice site	probably benign
R0371:Nbas	UTSW	12	13331095	missense	probably damaging	0.97
R0449:Nbas	UTSW	12	13519108	missense	probably benign	0.18
R0791:Nbas	UTSW	12	13482633	missense	probably benign	0.28
R0931:Nbas	UTSW	12	13331114	splice site	probably benign
R1236:Nbas	UTSW	12	13269241	missense	probably damaging	1.00
R1371:Nbas	UTSW	12	13482378	splice site	probably benign
R1567:Nbas	UTSW	12	13285278	missense	possibly damaging	0.70
R1587:Nbas	UTSW	12	13558685	missense	probably benign
R1719:Nbas	UTSW	12	13560977	critical splice donor site	probably null
R1747:Nbas	UTSW	12	13335898	missense	probably benign	0.00
R1777:Nbas	UTSW	12	13513562	missense	probably benign	0.16
R1848:Nbas	UTSW	12	13413597	missense	probably damaging	0.97
R1856:Nbas	UTSW	12	13474229	missense	possibly damaging	0.56
R1891:Nbas	UTSW	12	13390972	missense	possibly damaging	0.92
R1911:Nbas	UTSW	12	13566144	missense	probably benign
R1912:Nbas	UTSW	12	13566144	missense	probably benign
R2006:Nbas	UTSW	12	13414741	splice site	probably null
R2054:Nbas	UTSW	12	13474206	missense	probably benign	0.36
R2065:Nbas	UTSW	12	13566157	missense	probably damaging	1.00
R2089:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2156:Nbas	UTSW	12	13441509	missense	probably damaging	1.00
R2164:Nbas	UTSW	12	13330646	missense	possibly damaging	0.74
R2339:Nbas	UTSW	12	13362592	missense	probably benign	0.12
R2398:Nbas	UTSW	12	13432945	missense	probably damaging	0.99
R3806:Nbas	UTSW	12	13482504	missense	probably damaging	1.00
R3855:Nbas	UTSW	12	13279414	missense	possibly damaging	0.50
R4019:Nbas	UTSW	12	13482519	missense	probably damaging	1.00
R4083:Nbas	UTSW	12	13474191	missense	probably damaging	0.96
R4201:Nbas	UTSW	12	13374826	missense	probably benign	0.00
R4231:Nbas	UTSW	12	13393343	missense	probably damaging	0.98
R4552:Nbas	UTSW	12	13335937	critical splice donor site	probably null
R4560:Nbas	UTSW	12	13583527	missense	probably benign	0.00
R4728:Nbas	UTSW	12	13288739	missense	probably damaging	0.98
R4752:Nbas	UTSW	12	13482537	missense	possibly damaging	0.92
R4832:Nbas	UTSW	12	13483739	missense	probably benign	0.00
R4874:Nbas	UTSW	12	13321755	missense	probably damaging	1.00
R4988:Nbas	UTSW	12	13408265	missense	probably benign	0.45
R5020:Nbas	UTSW	12	13374712	missense	probably damaging	0.99
R5079:Nbas	UTSW	12	13374711	missense	probably damaging	1.00
R5129:Nbas	UTSW	12	13390960	missense	probably damaging	1.00
R5239:Nbas	UTSW	12	13441518	missense	probably benign	0.31
R5299:Nbas	UTSW	12	13441925	nonsense	probably null
R5351:Nbas	UTSW	12	13560849	missense	probably damaging	1.00
R5389:Nbas	UTSW	12	13534577	critical splice donor site	probably null
R5436:Nbas	UTSW	12	13374811	missense	probably damaging	1.00
R5654:Nbas	UTSW	12	13583475	missense	probably damaging	1.00
R5690:Nbas	UTSW	12	13336284	missense	probably damaging	1.00
R5842:Nbas	UTSW	12	13269266	critical splice donor site	probably null
R5959:Nbas	UTSW	12	13288801	missense	probably damaging	0.99
R5982:Nbas	UTSW	12	13393430	missense	probably benign	0.00
R6238:Nbas	UTSW	12	13482595	missense	probably benign
R6270:Nbas	UTSW	12	13324293	missense	probably damaging	1.00
R6363:Nbas	UTSW	12	13482576	missense	probably benign
R6424:Nbas	UTSW	12	13415733	critical splice donor site	probably null
R6458:Nbas	UTSW	12	13288749	missense	probably damaging	1.00
R6526:Nbas	UTSW	12	13405425	missense	probably damaging	1.00
R6654:Nbas	UTSW	12	13483874	nonsense	probably null
R7085:Nbas	UTSW	12	13285258	missense	probably damaging	1.00
R7179:Nbas	UTSW	12	13405397	missense	possibly damaging	0.94
R7197:Nbas	UTSW	12	13520750	missense	possibly damaging	0.75
R7378:Nbas	UTSW	12	13274219	missense	probably damaging	1.00
R7393:Nbas	UTSW	12	13393492	missense	probably damaging	1.00
R7425:Nbas	UTSW	12	13469880	missense	probably damaging	1.00
R7446:Nbas	UTSW	12	13393498	missense	probably benign	0.02
R7481:Nbas	UTSW	12	13356959	missense	probably damaging	0.97
R7626:Nbas	UTSW	12	13558660	missense	probably benign	0.00
R7678:Nbas	UTSW	12	13415661	missense	probably damaging	0.97
R7912:Nbas	UTSW	12	13405457	missense	possibly damaging	0.91
R7964:Nbas	UTSW	12	13356895	missense	probably damaging	0.99
R8193:Nbas	UTSW	12	13433009	missense	probably damaging	1.00
R8325:Nbas	UTSW	12	13288795	missense	probably damaging	1.00
R8405:Nbas	UTSW	12	13279393	missense	probably damaging	1.00
R8437:Nbas	UTSW	12	13566250	missense	possibly damaging	0.46
R8559:Nbas	UTSW	12	13352808	missense	probably benign	0.00
R8684:Nbas	UTSW	12	13336367	missense	probably damaging	1.00
R8826:Nbas	UTSW	12	13352874	splice site	probably benign
R8921:Nbas	UTSW	12	13413589	missense	probably benign
R8956:Nbas	UTSW	12	13432922	missense	possibly damaging	0.51
R9083:Nbas	UTSW	12	13335855	missense	possibly damaging	0.56
R9172:Nbas	UTSW	12	13374750	missense	possibly damaging	0.65
R9430:Nbas	UTSW	12	13321653	missense	probably benign	0.35
R9627:Nbas	UTSW	12	13300202	missense	possibly damaging	0.76
R9649:Nbas	UTSW	12	13583416	missense	probably damaging	1.00
RF013:Nbas	UTSW	12	13279408	missense	possibly damaging	0.54
T0722:Nbas	UTSW	12	13352808	missense	probably benign	0.00
Z1176:Nbas	UTSW	12	13483876	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GATTGCTGTTAATGAGAGACTCC -3'
(R):5'- CCCTGCATTGATTCCAAAATAGAAG -3'

Sequencing Primer
(F):5'- TGAGAGACTCCATTTGAGACAC -3'
(R):5'- CTCTTTCAGAAAAAAAGTCTTGA -3'

Posted On

2019-10-17