Incidental Mutation 'R7535:Dgkb'
ID583540
Institutional Source Beutler Lab
Gene Symbol Dgkb
Ensembl Gene ENSMUSG00000036095
Gene Namediacylglycerol kinase, beta
SynonymsC630029D13Rik, DGK-beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location37817726-38634239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38136647 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 265 (L265P)
Ref Sequence ENSEMBL: ENSMUSP00000037900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040500] [ENSMUST00000220990] [ENSMUST00000221176]
Predicted Effect probably damaging
Transcript: ENSMUST00000040500
AA Change: L265P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037900
Gene: ENSMUSG00000036095
AA Change: L265P

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 6 141 1.4e-49 PFAM
EFh 145 173 1.82e-4 SMART
EFh 190 218 1.18e-3 SMART
C1 235 286 7.11e-16 SMART
C1 302 350 9.25e-6 SMART
DAGKc 429 553 2.58e-68 SMART
DAGKa 573 753 8.02e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220990
AA Change: L265P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221176
AA Change: L272P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Diacylglycerol kinases (DGKs) are regulators of the intracellular concentration of the second messenger diacylglycerol (DAG) and thus play a key role in cellular processes. Nine mammalian isotypes have been identified, which are encoded by separate genes. Mammalian DGK isozymes contain a conserved catalytic (kinase) domain and a cysteine-rich domain (CRD). The protein encoded by this gene is a diacylglycerol kinase, beta isotype. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon distruption have defects in long term potentiation, synapase morphology, and in spatial reference and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Dgkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Dgkb APN 12 38438568 missense probably benign 0.05
IGL00768:Dgkb APN 12 38427479 missense probably benign 0.00
IGL00792:Dgkb APN 12 38214389 critical splice donor site probably null
IGL00934:Dgkb APN 12 38427456 missense probably damaging 0.98
IGL00970:Dgkb APN 12 38190083 missense probably damaging 1.00
IGL01152:Dgkb APN 12 38084234 missense probably damaging 1.00
IGL01489:Dgkb APN 12 38127385 critical splice donor site probably null
IGL01993:Dgkb APN 12 37982010 missense probably benign 0.19
IGL02212:Dgkb APN 12 38139414 missense probably damaging 1.00
IGL02687:Dgkb APN 12 38630629 missense possibly damaging 0.94
IGL02986:Dgkb APN 12 38100400 missense possibly damaging 0.88
IGL03155:Dgkb APN 12 38139459 missense probably damaging 1.00
IGL03174:Dgkb APN 12 38216054 missense possibly damaging 0.93
IGL03198:Dgkb APN 12 38136616 missense probably damaging 0.97
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0078:Dgkb UTSW 12 38136541 missense probably benign 0.35
R0271:Dgkb UTSW 12 38228026 missense probably damaging 1.00
R0359:Dgkb UTSW 12 38216031 missense probably benign 0.17
R0396:Dgkb UTSW 12 38190135 critical splice donor site probably null
R0547:Dgkb UTSW 12 38604158 missense probably benign 0.39
R0554:Dgkb UTSW 12 38216031 missense probably benign 0.17
R1903:Dgkb UTSW 12 38166777 critical splice donor site probably null
R2004:Dgkb UTSW 12 38084229 missense probably damaging 1.00
R2265:Dgkb UTSW 12 38190108 missense possibly damaging 0.61
R2941:Dgkb UTSW 12 38604123 missense possibly damaging 0.96
R3177:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R3277:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R4319:Dgkb UTSW 12 38438599 missense probably damaging 1.00
R4446:Dgkb UTSW 12 38184953 missense probably damaging 0.99
R4578:Dgkb UTSW 12 38427493 missense possibly damaging 0.87
R4601:Dgkb UTSW 12 38602820 missense probably damaging 0.96
R4799:Dgkb UTSW 12 38114568 missense possibly damaging 0.89
R4937:Dgkb UTSW 12 38114658 nonsense probably null
R5380:Dgkb UTSW 12 38127300 missense possibly damaging 0.89
R5485:Dgkb UTSW 12 38127364 missense probably damaging 1.00
R5556:Dgkb UTSW 12 38127364 missense probably damaging 1.00
R6198:Dgkb UTSW 12 38173823 missense probably benign
R6467:Dgkb UTSW 12 38084224 missense possibly damaging 0.65
R6467:Dgkb UTSW 12 38604105 missense probably damaging 1.00
R6792:Dgkb UTSW 12 38100425 missense possibly damaging 0.48
R7056:Dgkb UTSW 12 38100493 missense probably benign
R7116:Dgkb UTSW 12 37981990 missense probably benign 0.00
R7251:Dgkb UTSW 12 37981986 missense possibly damaging 0.77
R7265:Dgkb UTSW 12 38184932 missense possibly damaging 0.91
R7268:Dgkb UTSW 12 38147555 nonsense probably null
R7342:Dgkb UTSW 12 38100433 missense probably benign 0.00
R7540:Dgkb UTSW 12 37981790 start gained probably benign
R7584:Dgkb UTSW 12 38139392 splice site probably null
R7714:Dgkb UTSW 12 38630593 missense probably damaging 0.99
R7885:Dgkb UTSW 12 38139426 missense probably damaging 1.00
R7968:Dgkb UTSW 12 38139426 missense probably damaging 1.00
R8012:Dgkb UTSW 12 38139486 missense probably benign 0.31
R8050:Dgkb UTSW 12 38124217 missense probably benign 0.38
X0023:Dgkb UTSW 12 38227989 missense probably benign 0.00
X0027:Dgkb UTSW 12 38228125 critical splice donor site probably null
Z1176:Dgkb UTSW 12 37981996 missense possibly damaging 0.77
Z1176:Dgkb UTSW 12 38136613 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTCTTGTACTGGAGAGAGCC -3'
(R):5'- AAGGAAGTTGGCCAGTGACC -3'

Sequencing Primer
(F):5'- CCTGAGCTCGATTGGCACTTG -3'
(R):5'- TGGCCAGTGACCTGAACATTG -3'
Posted On2019-10-17