Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Ttc6'

583541

Institutional Source

Beutler Lab

Gene Symbol

Ttc6

Ensembl Gene

ENSMUSG00000046782

Gene Name

tetratricopeptide repeat domain 6

Synonyms

EG639426, LOC217602, Gm9813

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57564113-57737928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57576519 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 235 (S235G)

Ref Sequence

ENSEMBL: ENSMUSP00000098946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101398] [ENSMUST00000172939]

AlphaFold

G3UYY4

Predicted Effect

probably benign
Transcript: ENSMUST00000101398
AA Change: S235G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000098946
Gene: ENSMUSG00000046782
AA Change: S235G

Domain	Start	End	E-Value	Type
coiled coil region	18	42	N/A	INTRINSIC
low complexity region	146	162	N/A	INTRINSIC
low complexity region	188	212	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172939
AA Change: S235G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: S235G

Domain	Start	End	E-Value	Type
coiled coil region	18	42	N/A	INTRINSIC
low complexity region	146	162	N/A	INTRINSIC
low complexity region	188	212	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	486	495	N/A	INTRINSIC
low complexity region	670	685	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC
TPR	889	922	2e-4	SMART
TPR	957	989	2.36e1	SMART
TPR	990	1022	2.63e1	SMART
TPR	1023	1056	9.39e-1	SMART
TPR	1057	1090	3.78e-5	SMART
Blast:TPR	1126	1157	1e-11	BLAST
SEL1	1160	1192	3.39e1	SMART
TPR	1160	1194	4.44e1	SMART
TPR	1195	1228	7.87e0	SMART
Blast:TPR	1229	1262	1e-11	BLAST
TPR	1297	1330	1.24e0	SMART
SEL1	1341	1372	9.26e-1	SMART
TPR	1341	1374	3.45e-8	SMART
TPR	1375	1407	8.76e-1	SMART
TPR	1408	1441	1.45e-1	SMART
TPR	1442	1475	1.36e1	SMART
TPR	1476	1509	7.34e-3	SMART
TPR	1513	1546	1.01e0	SMART
TPR	1547	1580	2.55e-2	SMART
TPR	1581	1617	2.43e1	SMART
Blast:TPR	1618	1651	4e-12	BLAST
TPR	1652	1685	7.87e0	SMART
TPR	1686	1718	2.35e-1	SMART
SEL1	1719	1750	1.21e2	SMART
TPR	1719	1752	1.65e-5	SMART
TPR	1753	1786	1.66e-1	SMART
TPR	1787	1820	1.45e-1	SMART
TPR	1821	1854	3.27e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Ttc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03278:Ttc6	APN	12	57622026	missense	probably damaging	0.99
polonius	UTSW	12	57658142	splice site	probably null
tybalt	UTSW	12	57673756	missense	possibly damaging	0.85
IGL02802:Ttc6	UTSW	12	57575868	missense	probably benign	0.14
PIT4802001:Ttc6	UTSW	12	57725676	missense	possibly damaging	0.89
R0698:Ttc6	UTSW	12	57673216	missense	probably benign	0.04
R0988:Ttc6	UTSW	12	57688649	splice site	probably benign
R1290:Ttc6	UTSW	12	57660413	missense	probably benign	0.00
R1338:Ttc6	UTSW	12	57616369	missense	probably benign	0.10
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1481:Ttc6	UTSW	12	57737130	missense	probably damaging	1.00
R1488:Ttc6	UTSW	12	57649515	missense	possibly damaging	0.66
R1558:Ttc6	UTSW	12	57686346	missense	probably benign	0.14
R1570:Ttc6	UTSW	12	57674763	missense	probably damaging	0.98
R1619:Ttc6	UTSW	12	57737668	missense	possibly damaging	0.73
R1819:Ttc6	UTSW	12	57694500	critical splice donor site	probably null
R1826:Ttc6	UTSW	12	57660247	missense	probably benign	0.10
R1863:Ttc6	UTSW	12	57714095	missense	probably benign	0.04
R1872:Ttc6	UTSW	12	57704552	critical splice donor site	probably null
R1887:Ttc6	UTSW	12	57673258	missense	probably benign	0.04
R1937:Ttc6	UTSW	12	57616323	missense	probably benign	0.02
R2014:Ttc6	UTSW	12	57576217	missense	possibly damaging	0.92
R2056:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2058:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2059:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2152:Ttc6	UTSW	12	57705552	missense	probably damaging	0.98
R2179:Ttc6	UTSW	12	57673118	missense	possibly damaging	0.62
R2275:Ttc6	UTSW	12	57702298	missense	probably benign	0.01
R2432:Ttc6	UTSW	12	57622035	missense	possibly damaging	0.79
R2474:Ttc6	UTSW	12	57575927	missense	probably benign	0.37
R2853:Ttc6	UTSW	12	57576181	missense	probably damaging	0.96
R3848:Ttc6	UTSW	12	57677146	missense	probably damaging	0.97
R3853:Ttc6	UTSW	12	57728549	missense	possibly damaging	0.88
R3950:Ttc6	UTSW	12	57649506	missense	probably damaging	0.97
R3953:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3954:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3955:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3957:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R4135:Ttc6	UTSW	12	57632795	intron	probably benign
R4387:Ttc6	UTSW	12	57643050	missense	probably benign	0.00
R4577:Ttc6	UTSW	12	57576655	missense	probably benign	0.22
R4747:Ttc6	UTSW	12	57674692	missense	possibly damaging	0.86
R4779:Ttc6	UTSW	12	57729451	missense	probably damaging	1.00
R4803:Ttc6	UTSW	12	57728505	missense	probably damaging	1.00
R4871:Ttc6	UTSW	12	57702356	missense	probably damaging	0.96
R4898:Ttc6	UTSW	12	57660240	missense	probably benign	0.00
R4930:Ttc6	UTSW	12	57673823	critical splice donor site	probably null
R4946:Ttc6	UTSW	12	57643140	missense	probably benign	0.01
R5257:Ttc6	UTSW	12	57702275	missense	possibly damaging	0.92
R5303:Ttc6	UTSW	12	57575820	missense	possibly damaging	0.90
R5385:Ttc6	UTSW	12	57643035	splice site	probably null
R5402:Ttc6	UTSW	12	57737031	nonsense	probably null
R5428:Ttc6	UTSW	12	57689834	missense	probably null	0.98
R5436:Ttc6	UTSW	12	57674594	splice site	probably null
R5646:Ttc6	UTSW	12	57576019	missense	probably damaging	0.99
R5697:Ttc6	UTSW	12	57677214	missense	probably benign	0.22
R5792:Ttc6	UTSW	12	57673204	missense	possibly damaging	0.71
R5808:Ttc6	UTSW	12	57617611	missense	possibly damaging	0.84
R5842:Ttc6	UTSW	12	57737016	missense	probably damaging	1.00
R5935:Ttc6	UTSW	12	57673804	missense	probably damaging	0.98
R6144:Ttc6	UTSW	12	57673100	missense	possibly damaging	0.83
R6155:Ttc6	UTSW	12	57737616	missense	possibly damaging	0.84
R6283:Ttc6	UTSW	12	57702262	missense	possibly damaging	0.95
R6371:Ttc6	UTSW	12	57728463	missense	possibly damaging	0.89
R6715:Ttc6	UTSW	12	57674770	critical splice donor site	probably null
R6738:Ttc6	UTSW	12	57688640	missense	probably damaging	0.99
R6795:Ttc6	UTSW	12	57704413	missense	probably damaging	0.96
R6959:Ttc6	UTSW	12	57658142	splice site	probably null
R7053:Ttc6	UTSW	12	57660532	missense	probably benign	0.01
R7125:Ttc6	UTSW	12	57576339	missense	probably benign	0.00
R7259:Ttc6	UTSW	12	57576184	missense	probably benign	0.00
R7304:Ttc6	UTSW	12	57576051	missense	probably damaging	0.96
R7369:Ttc6	UTSW	12	57672931	critical splice acceptor site	probably null
R7409:Ttc6	UTSW	12	57696986	missense	probably damaging	0.99
R7429:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7430:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7492:Ttc6	UTSW	12	57673136	missense	probably benign	0.02
R7866:Ttc6	UTSW	12	57674649	missense	probably damaging	0.97
R7901:Ttc6	UTSW	12	57688567	missense	probably damaging	1.00
R7944:Ttc6	UTSW	12	57660443	missense	possibly damaging	0.46
R7945:Ttc6	UTSW	12	57660443	missense	possibly damaging	0.46
R7965:Ttc6	UTSW	12	57673756	missense	possibly damaging	0.85
R8062:Ttc6	UTSW	12	57736978	missense	possibly damaging	0.90
R8119:Ttc6	UTSW	12	57705643	missense	possibly damaging	0.78
R8142:Ttc6	UTSW	12	57697472	missense	possibly damaging	0.87
R8154:Ttc6	UTSW	12	57729424	missense	probably damaging	1.00
R8171:Ttc6	UTSW	12	57673310	missense	probably damaging	1.00
R8335:Ttc6	UTSW	12	57660291	missense	probably benign	0.00
R8343:Ttc6	UTSW	12	57660496	missense	possibly damaging	0.47
R8696:Ttc6	UTSW	12	57737706	missense	probably benign	0.20
R8875:Ttc6	UTSW	12	57704413	missense	probably damaging	0.96
R8875:Ttc6	UTSW	12	57729408	missense	possibly damaging	0.46
R8876:Ttc6	UTSW	12	57737703	missense	possibly damaging	0.81
R8924:Ttc6	UTSW	12	57651004	nonsense	probably null
R8944:Ttc6	UTSW	12	57643040	missense
R8956:Ttc6	UTSW	12	57728410	nonsense	probably null
R9009:Ttc6	UTSW	12	57697433	missense	probably damaging	1.00
R9020:Ttc6	UTSW	12	57705580	missense	probably damaging	1.00
R9051:Ttc6	UTSW	12	57737163	missense	probably damaging	1.00
R9232:Ttc6	UTSW	12	57729424	missense	probably damaging	1.00
R9291:Ttc6	UTSW	12	57575944	missense	probably damaging	0.99
R9304:Ttc6	UTSW	12	57729331	missense	probably damaging	0.99
R9309:Ttc6	UTSW	12	57706863	missense	possibly damaging	0.69
R9331:Ttc6	UTSW	12	57673723	missense	probably damaging	1.00
R9398:Ttc6	UTSW	12	57737618	nonsense	probably null
R9430:Ttc6	UTSW	12	57686407	missense	probably damaging	1.00
R9632:Ttc6	UTSW	12	57617513	missense	probably benign
R9688:Ttc6	UTSW	12	57673816	missense	possibly damaging	0.92
R9732:Ttc6	UTSW	12	57728549	missense	probably benign	0.36
R9740:Ttc6	UTSW	12	57689710	missense	probably damaging	1.00
R9749:Ttc6	UTSW	12	57654773	missense	probably benign	0.00
X0021:Ttc6	UTSW	12	57576118	missense	probably damaging	0.96
X0058:Ttc6	UTSW	12	57706851	missense	probably damaging	0.99
Z1176:Ttc6	UTSW	12	57697375	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GGCACGTTATGAAGACCAGG -3'
(R):5'- ACCTACTTCCATTGCGATGTCG -3'

Sequencing Primer
(F):5'- TCCGCGGGACTTCTACATG -3'
(R):5'- GTAGTTCTGGCCCAGGATGCTC -3'

Posted On

2019-10-17