Incidental Mutation 'R7535:Ttc6'
ID583541
Institutional Source Beutler Lab
Gene Symbol Ttc6
Ensembl Gene ENSMUSG00000046782
Gene Nametetratricopeptide repeat domain 6
SynonymsEG639426, LOC217602, Gm9813
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location57564113-57737928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57576519 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 235 (S235G)
Ref Sequence ENSEMBL: ENSMUSP00000098946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101398] [ENSMUST00000172939]
Predicted Effect probably benign
Transcript: ENSMUST00000101398
AA Change: S235G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098946
Gene: ENSMUSG00000046782
AA Change: S235G

DomainStartEndE-ValueType
coiled coil region 18 42 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
low complexity region 188 212 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172939
AA Change: S235G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: S235G

DomainStartEndE-ValueType
coiled coil region 18 42 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
low complexity region 188 212 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
TPR 889 922 2e-4 SMART
TPR 957 989 2.36e1 SMART
TPR 990 1022 2.63e1 SMART
TPR 1023 1056 9.39e-1 SMART
TPR 1057 1090 3.78e-5 SMART
Blast:TPR 1126 1157 1e-11 BLAST
SEL1 1160 1192 3.39e1 SMART
TPR 1160 1194 4.44e1 SMART
TPR 1195 1228 7.87e0 SMART
Blast:TPR 1229 1262 1e-11 BLAST
TPR 1297 1330 1.24e0 SMART
SEL1 1341 1372 9.26e-1 SMART
TPR 1341 1374 3.45e-8 SMART
TPR 1375 1407 8.76e-1 SMART
TPR 1408 1441 1.45e-1 SMART
TPR 1442 1475 1.36e1 SMART
TPR 1476 1509 7.34e-3 SMART
TPR 1513 1546 1.01e0 SMART
TPR 1547 1580 2.55e-2 SMART
TPR 1581 1617 2.43e1 SMART
Blast:TPR 1618 1651 4e-12 BLAST
TPR 1652 1685 7.87e0 SMART
TPR 1686 1718 2.35e-1 SMART
SEL1 1719 1750 1.21e2 SMART
TPR 1719 1752 1.65e-5 SMART
TPR 1753 1786 1.66e-1 SMART
TPR 1787 1820 1.45e-1 SMART
TPR 1821 1854 3.27e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Ttc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03278:Ttc6 APN 12 57622026 missense probably damaging 0.99
IGL02802:Ttc6 UTSW 12 57575868 missense probably benign 0.14
PIT4802001:Ttc6 UTSW 12 57725676 missense possibly damaging 0.89
R0698:Ttc6 UTSW 12 57673216 missense probably benign 0.04
R0988:Ttc6 UTSW 12 57688649 splice site probably benign
R1290:Ttc6 UTSW 12 57660413 missense probably benign 0.00
R1338:Ttc6 UTSW 12 57616369 missense probably benign 0.10
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1468:Ttc6 UTSW 12 57674677 missense possibly damaging 0.54
R1481:Ttc6 UTSW 12 57737130 missense probably damaging 1.00
R1488:Ttc6 UTSW 12 57649515 missense possibly damaging 0.66
R1558:Ttc6 UTSW 12 57686346 missense probably benign 0.14
R1570:Ttc6 UTSW 12 57674763 missense probably damaging 0.98
R1619:Ttc6 UTSW 12 57737668 missense possibly damaging 0.73
R1819:Ttc6 UTSW 12 57694500 critical splice donor site probably null
R1826:Ttc6 UTSW 12 57660247 missense probably benign 0.10
R1863:Ttc6 UTSW 12 57714095 missense probably benign 0.04
R1872:Ttc6 UTSW 12 57704552 critical splice donor site probably null
R1887:Ttc6 UTSW 12 57673258 missense probably benign 0.04
R1937:Ttc6 UTSW 12 57616323 missense probably benign 0.02
R2014:Ttc6 UTSW 12 57576217 missense possibly damaging 0.92
R2056:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2058:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2059:Ttc6 UTSW 12 57737693 missense probably benign 0.08
R2152:Ttc6 UTSW 12 57705552 missense probably damaging 0.98
R2179:Ttc6 UTSW 12 57673118 missense possibly damaging 0.62
R2275:Ttc6 UTSW 12 57702298 missense probably benign 0.01
R2432:Ttc6 UTSW 12 57622035 missense possibly damaging 0.79
R2474:Ttc6 UTSW 12 57575927 missense probably benign 0.37
R2853:Ttc6 UTSW 12 57576181 missense probably damaging 0.96
R3848:Ttc6 UTSW 12 57677146 missense probably damaging 0.97
R3853:Ttc6 UTSW 12 57728549 missense possibly damaging 0.88
R3950:Ttc6 UTSW 12 57649506 missense probably damaging 0.97
R3953:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3954:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3955:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R3957:Ttc6 UTSW 12 57697452 missense probably benign 0.03
R4135:Ttc6 UTSW 12 57632795 intron probably benign
R4387:Ttc6 UTSW 12 57643050 missense probably benign 0.00
R4577:Ttc6 UTSW 12 57576655 missense probably benign 0.22
R4747:Ttc6 UTSW 12 57674692 missense possibly damaging 0.86
R4779:Ttc6 UTSW 12 57729451 missense probably damaging 1.00
R4803:Ttc6 UTSW 12 57728505 missense probably damaging 1.00
R4871:Ttc6 UTSW 12 57702356 missense probably damaging 0.96
R4898:Ttc6 UTSW 12 57660240 missense probably benign 0.00
R4930:Ttc6 UTSW 12 57673823 critical splice donor site probably null
R4946:Ttc6 UTSW 12 57643140 missense probably benign 0.01
R5257:Ttc6 UTSW 12 57702275 missense possibly damaging 0.92
R5303:Ttc6 UTSW 12 57575820 missense possibly damaging 0.90
R5385:Ttc6 UTSW 12 57643035 splice site probably null
R5402:Ttc6 UTSW 12 57737031 nonsense probably null
R5428:Ttc6 UTSW 12 57689834 missense probably null 0.98
R5436:Ttc6 UTSW 12 57674594 splice site probably null
R5646:Ttc6 UTSW 12 57576019 missense probably damaging 0.99
R5697:Ttc6 UTSW 12 57677214 missense probably benign 0.22
R5792:Ttc6 UTSW 12 57673204 missense possibly damaging 0.71
R5808:Ttc6 UTSW 12 57617611 missense possibly damaging 0.84
R5842:Ttc6 UTSW 12 57737016 missense probably damaging 1.00
R5935:Ttc6 UTSW 12 57673804 missense probably damaging 0.98
R6144:Ttc6 UTSW 12 57673100 missense possibly damaging 0.83
R6155:Ttc6 UTSW 12 57737616 missense possibly damaging 0.84
R6283:Ttc6 UTSW 12 57702262 missense possibly damaging 0.95
R6371:Ttc6 UTSW 12 57728463 missense possibly damaging 0.89
R6715:Ttc6 UTSW 12 57674770 critical splice donor site probably null
R6738:Ttc6 UTSW 12 57688640 missense probably damaging 0.99
R6795:Ttc6 UTSW 12 57704413 missense probably damaging 0.96
R6959:Ttc6 UTSW 12 57658142 splice site probably null
R7053:Ttc6 UTSW 12 57660532 missense probably benign 0.01
R7125:Ttc6 UTSW 12 57576339 missense probably benign 0.00
R7259:Ttc6 UTSW 12 57576184 missense probably benign 0.00
R7304:Ttc6 UTSW 12 57576051 missense probably damaging 0.96
R7369:Ttc6 UTSW 12 57672931 critical splice acceptor site probably null
R7409:Ttc6 UTSW 12 57696986 missense probably damaging 0.99
R7429:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7430:Ttc6 UTSW 12 57658102 missense probably benign 0.00
R7492:Ttc6 UTSW 12 57673136 missense probably benign 0.02
R7866:Ttc6 UTSW 12 57674649 missense probably damaging 0.97
R7901:Ttc6 UTSW 12 57688567 missense probably damaging 1.00
R7949:Ttc6 UTSW 12 57674649 missense probably damaging 0.97
R7984:Ttc6 UTSW 12 57688567 missense probably damaging 1.00
R8062:Ttc6 UTSW 12 57736978 missense possibly damaging 0.90
X0021:Ttc6 UTSW 12 57576118 missense probably damaging 0.96
X0058:Ttc6 UTSW 12 57706851 missense probably damaging 0.99
Z1176:Ttc6 UTSW 12 57697375 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGCACGTTATGAAGACCAGG -3'
(R):5'- ACCTACTTCCATTGCGATGTCG -3'

Sequencing Primer
(F):5'- TCCGCGGGACTTCTACATG -3'
(R):5'- GTAGTTCTGGCCCAGGATGCTC -3'
Posted On2019-10-17