Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Dsp'

583545

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38192789 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1517 (S1517P)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000124830
AA Change: S1517P

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: S1517P

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127906

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTGAAGAACACTCTAGCC -3'
(R):5'- TGGATCCTCGTGATGTCCTG -3'

Sequencing Primer
(F):5'- ACTGGCTCAGAGATGTCTCAG -3'
(R):5'- GTGATGTCCTGATCCTTCACGG -3'

Posted On

2019-10-17