Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Agtpbp1'

583546

Institutional Source

Beutler Lab

Gene Symbol

Agtpbp1

Ensembl Gene

ENSMUSG00000021557

Gene Name

ATP/GTP binding protein 1

Synonyms

2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik

MMRRC Submission

Accession Numbers

Genbank: NM_023328; MGI: 2159437

Essential gene?

Possibly essential (E-score: 0.723) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59445742-59585227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59504253 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 415 (T415A)

Ref Sequence

ENSEMBL: ENSMUSP00000022040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000109830] [ENSMUST00000164215] [ENSMUST00000165370] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000171606]

AlphaFold

Q641K1

Predicted Effect

probably benign
Transcript: ENSMUST00000022040
AA Change: T415A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: T415A

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	851	1099	1.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109830
AA Change: T415A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: T415A

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.3e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: T302A

Domain	Start	End	E-Value	Type
low complexity region	250	279	N/A	INTRINSIC
low complexity region	477	491	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164215
AA Change: T415A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: T415A

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	847	1123	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165370

Predicted Effect

probably benign
Transcript: ENSMUST00000165477

Predicted Effect

probably benign
Transcript: ENSMUST00000169745

Predicted Effect

probably benign
Transcript: ENSMUST00000170555
AA Change: T415A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: T415A

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.4e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
low complexity region	787	795	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171606
AA Change: T415A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: T415A

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.3e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Agtpbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Agtpbp1	APN	13	59450172	missense	probably damaging	1.00
IGL00808:Agtpbp1	APN	13	59462094	missense	possibly damaging	0.84
IGL01298:Agtpbp1	APN	13	59504226	missense	possibly damaging	0.77
IGL01628:Agtpbp1	APN	13	59508063	splice site	probably benign
IGL01921:Agtpbp1	APN	13	59512483	missense	possibly damaging	0.71
IGL02189:Agtpbp1	APN	13	59500461	missense	probably benign	0.01
IGL02325:Agtpbp1	APN	13	59500489	missense	probably benign	0.01
IGL02700:Agtpbp1	APN	13	59528419	missense	probably damaging	1.00
IGL02821:Agtpbp1	APN	13	59482601	missense	possibly damaging	0.69
IGL03130:Agtpbp1	APN	13	59474589	missense	possibly damaging	0.73
IGL03167:Agtpbp1	APN	13	59532080	splice site	probably benign
IGL03218:Agtpbp1	APN	13	59500207	missense	possibly damaging	0.94
bobs	UTSW	13	59482571	missense	possibly damaging	0.53
drunk	UTSW	13	59512322	critical splice donor site	probably benign
gru	UTSW	13	59473746	missense	probably damaging	1.00
rio	UTSW	13	59525241	critical splice acceptor site	probably benign
shreds	UTSW	13	59462088	missense	probably damaging	1.00
Unfocused	UTSW	13	59462070	nonsense	probably null
wobble	UTSW	13	59474550	missense	probably damaging	1.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0276:Agtpbp1	UTSW	13	59462031	missense	possibly damaging	0.93
R0413:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R0559:Agtpbp1	UTSW	13	59497000	missense	probably benign	0.32
R0848:Agtpbp1	UTSW	13	59533939	intron	probably benign
R0943:Agtpbp1	UTSW	13	59500602	missense	probably benign
R1196:Agtpbp1	UTSW	13	59450318	unclassified	probably benign
R1421:Agtpbp1	UTSW	13	59495575	missense	possibly damaging	0.86
R1531:Agtpbp1	UTSW	13	59500634	splice site	probably null
R1833:Agtpbp1	UTSW	13	59465983	critical splice donor site	probably null
R1864:Agtpbp1	UTSW	13	59450202	missense	possibly damaging	0.92
R1994:Agtpbp1	UTSW	13	59531058	missense	probably damaging	1.00
R1995:Agtpbp1	UTSW	13	59531058	missense	probably damaging	1.00
R2001:Agtpbp1	UTSW	13	59475803	frame shift	probably null
R2006:Agtpbp1	UTSW	13	59500321	missense	probably benign	0.00
R2397:Agtpbp1	UTSW	13	59474569	missense	probably benign	0.10
R2918:Agtpbp1	UTSW	13	59497015	missense	possibly damaging	0.90
R3873:Agtpbp1	UTSW	13	59460596	missense	possibly damaging	0.88
R3924:Agtpbp1	UTSW	13	59500407	missense	probably benign	0.01
R4649:Agtpbp1	UTSW	13	59528399	missense	possibly damaging	0.89
R4913:Agtpbp1	UTSW	13	59500072	missense	probably damaging	1.00
R4933:Agtpbp1	UTSW	13	59500572	missense	probably benign
R4969:Agtpbp1	UTSW	13	59500578	missense	probably benign
R5066:Agtpbp1	UTSW	13	59474550	missense	probably damaging	1.00
R5139:Agtpbp1	UTSW	13	59500213	missense	probably damaging	0.99
R5194:Agtpbp1	UTSW	13	59500639	missense	probably benign	0.19
R5269:Agtpbp1	UTSW	13	59473743	missense	probably damaging	1.00
R5352:Agtpbp1	UTSW	13	59473746	missense	probably damaging	1.00
R5558:Agtpbp1	UTSW	13	59482580	missense	probably benign	0.05
R5687:Agtpbp1	UTSW	13	59500515	missense	probably benign
R5824:Agtpbp1	UTSW	13	59466099	missense	probably damaging	1.00
R5979:Agtpbp1	UTSW	13	59534046	nonsense	probably null
R6109:Agtpbp1	UTSW	13	59473746	missense	probably damaging	1.00
R6264:Agtpbp1	UTSW	13	59450300	missense	possibly damaging	0.89
R6413:Agtpbp1	UTSW	13	59500020	missense	possibly damaging	0.90
R6498:Agtpbp1	UTSW	13	59477040	missense	possibly damaging	0.71
R6747:Agtpbp1	UTSW	13	59544353	splice site	probably null
R6950:Agtpbp1	UTSW	13	59450266	missense	probably benign	0.32
R7030:Agtpbp1	UTSW	13	59504294	missense	probably damaging	1.00
R7180:Agtpbp1	UTSW	13	59466038	missense	probably benign	0.11
R7196:Agtpbp1	UTSW	13	59533180	missense	possibly damaging	0.83
R7683:Agtpbp1	UTSW	13	59512498	missense	probably damaging	1.00
R7713:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R8081:Agtpbp1	UTSW	13	59528407	nonsense	probably null
R8210:Agtpbp1	UTSW	13	59482571	missense	possibly damaging	0.53
R8861:Agtpbp1	UTSW	13	59495473	missense	probably damaging	1.00
R9163:Agtpbp1	UTSW	13	59462070	nonsense	probably null
R9199:Agtpbp1	UTSW	13	59465994	missense	probably benign	0.00
R9389:Agtpbp1	UTSW	13	59466070	missense	probably damaging	1.00
R9414:Agtpbp1	UTSW	13	59462088	missense	probably damaging	1.00
R9435:Agtpbp1	UTSW	13	59474615	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CCTGTAAACAAAGACCGGGG -3'
(R):5'- TGCTGAGATTAACCCTCACCAG -3'

Sequencing Primer
(F):5'- GGGCCATTTCCTCAGACATG -3'
(R):5'- AGACAACAGAGTCAATACCAGTG -3'

Posted On

2019-10-17