Incidental Mutation 'R7535:Zmym2'
ID583548
Institutional Source Beutler Lab
Gene Symbol Zmym2
Ensembl Gene ENSMUSG00000021945
Gene Namezinc finger, MYM-type 2
SynonymsRAMP, FIM, MYM, Zfp198, SCLL
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56886653-56962701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56957079 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1265 (S1265P)
Ref Sequence ENSEMBL: ENSMUSP00000022511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022511]
Predicted Effect probably damaging
Transcript: ENSMUST00000022511
AA Change: S1265P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022511
Gene: ENSMUSG00000021945
AA Change: S1265P

DomainStartEndE-ValueType
TRASH 330 366 1.55e-5 SMART
TRASH 372 412 7.69e-1 SMART
TRASH 424 459 7.5e1 SMART
TRASH 466 505 6.53e-4 SMART
Pfam:zf-FCS 527 569 1.8e-9 PFAM
TRASH 583 619 4.79e1 SMART
TRASH 638 674 8.49e-3 SMART
TRASH 680 715 7.28e-2 SMART
TRASH 726 761 1.95e-2 SMART
TRASH 767 802 3.89e1 SMART
low complexity region 881 895 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
Pfam:DUF3504 1191 1359 7.3e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: This gene encodes a protein that contains nine MYM-type zinc finger motifs. Expression of this gene may mediate the inhibition of hematopoietic cell development during ontogeny, and the encoded protein may also play a role in transforming growth factor-beta signaling as a Smad binding protein. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc22a29 A G 19: 8,169,978 F340S probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Other mutations in Zmym2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Zmym2 APN 14 56947937 splice site probably benign
IGL00587:Zmym2 APN 14 56903360 missense possibly damaging 0.86
IGL00736:Zmym2 APN 14 56903211 missense probably benign 0.01
IGL00753:Zmym2 APN 14 56957060 nonsense probably null
IGL01608:Zmym2 APN 14 56948015 missense possibly damaging 0.57
IGL01744:Zmym2 APN 14 56946572 missense probably benign 0.24
IGL02150:Zmym2 APN 14 56911069 splice site probably benign
IGL02186:Zmym2 APN 14 56943351 missense probably benign 0.09
IGL02654:Zmym2 APN 14 56911315 missense probably damaging 1.00
IGL02960:Zmym2 APN 14 56938413 missense probably benign 0.09
IGL03104:Zmym2 APN 14 56950327 missense possibly damaging 0.88
IGL03162:Zmym2 APN 14 56914043 missense probably benign 0.24
IGL03356:Zmym2 APN 14 56957060 nonsense probably null
IGL03412:Zmym2 APN 14 56959719 nonsense probably null
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0131:Zmym2 UTSW 14 56943258 missense probably benign
R0132:Zmym2 UTSW 14 56943258 missense probably benign
R0270:Zmym2 UTSW 14 56949684 splice site probably null
R0834:Zmym2 UTSW 14 56956963 missense probably damaging 1.00
R1071:Zmym2 UTSW 14 56959821 missense possibly damaging 0.93
R1386:Zmym2 UTSW 14 56913091 missense probably damaging 1.00
R1442:Zmym2 UTSW 14 56943327 missense probably damaging 0.99
R1472:Zmym2 UTSW 14 56911183 missense probably benign 0.20
R1595:Zmym2 UTSW 14 56920730 missense probably benign 0.25
R1598:Zmym2 UTSW 14 56902769 missense possibly damaging 0.94
R1598:Zmym2 UTSW 14 56914067 missense probably damaging 1.00
R1916:Zmym2 UTSW 14 56959842 missense probably damaging 1.00
R2261:Zmym2 UTSW 14 56928262 missense probably damaging 1.00
R2393:Zmym2 UTSW 14 56920723 missense probably benign 0.17
R2866:Zmym2 UTSW 14 56928248 missense probably damaging 1.00
R3727:Zmym2 UTSW 14 56919349 splice site probably benign
R3847:Zmym2 UTSW 14 56921499 splice site probably benign
R4043:Zmym2 UTSW 14 56958308 splice site probably benign
R4074:Zmym2 UTSW 14 56903004 missense probably damaging 0.99
R4343:Zmym2 UTSW 14 56921562 missense probably damaging 0.99
R4420:Zmym2 UTSW 14 56956878 missense probably damaging 0.98
R4645:Zmym2 UTSW 14 56928307 missense probably damaging 1.00
R5015:Zmym2 UTSW 14 56921594 missense probably damaging 1.00
R5038:Zmym2 UTSW 14 56956180 missense possibly damaging 0.86
R5223:Zmym2 UTSW 14 56946514 missense probably benign
R5364:Zmym2 UTSW 14 56920645 missense possibly damaging 0.58
R5488:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5489:Zmym2 UTSW 14 56956255 missense possibly damaging 0.56
R5818:Zmym2 UTSW 14 56946529 missense probably benign
R6160:Zmym2 UTSW 14 56950309 missense probably damaging 1.00
R6437:Zmym2 UTSW 14 56903004 missense probably damaging 1.00
R7107:Zmym2 UTSW 14 56902712 missense probably benign 0.01
R7153:Zmym2 UTSW 14 56950202 missense probably benign 0.16
R7337:Zmym2 UTSW 14 56944100 missense probably benign 0.04
R7730:Zmym2 UTSW 14 56956181 missense possibly damaging 0.95
R7779:Zmym2 UTSW 14 56928283 missense probably damaging 1.00
R7849:Zmym2 UTSW 14 56946563 missense probably benign 0.03
R7932:Zmym2 UTSW 14 56946563 missense probably benign 0.03
Z1176:Zmym2 UTSW 14 56912999 missense possibly damaging 0.94
Z1177:Zmym2 UTSW 14 56913962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATCCCACTCTCCAGTAG -3'
(R):5'- GGCAAGTTGAACATTCCCACC -3'

Sequencing Primer
(F):5'- CCAGTAGCACTTTTGAATACCC -3'
(R):5'- CAGAAGTCCTAGGTTGAGTTCCC -3'
Posted On2019-10-17