Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Olfr167'

583550

Institutional Source

Beutler Lab

Gene Symbol

Olfr167

Ensembl Gene

ENSMUSG00000045341

Gene Name

olfactory receptor 167

Synonyms

MOR272-1, GA_x54KRFPKG5P-15963726-15962788

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19509558-19522266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 19514794 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 281 (T281A)

Ref Sequence

ENSEMBL: ENSMUSP00000150102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]

AlphaFold

Q8VGJ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000054606
AA Change: T281A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: T281A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	306	4.8e-46	PFAM
Pfam:7TM_GPCR_Srsx	33	295	1.2e-6	PFAM
Pfam:7tm_1	40	289	1.8e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214315
AA Change: T281A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.5625

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cdh20	T	A	1: 104,975,043	D486E	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Olfr167

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01535:Olfr167	APN	16	19515478	missense	probably benign	0.01
IGL02115:Olfr167	APN	16	19515103	missense	probably damaging	1.00
IGL02562:Olfr167	APN	16	19514964	missense	possibly damaging	0.74
BB008:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
BB018:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
R0366:Olfr167	UTSW	16	19514848	missense	probably benign	0.13
R0673:Olfr167	UTSW	16	19515396	missense	probably damaging	1.00
R1187:Olfr167	UTSW	16	19515046	missense	probably benign	0.01
R1237:Olfr167	UTSW	16	19515625	missense	probably benign	0.01
R1975:Olfr167	UTSW	16	19514836	missense	probably damaging	0.99
R1977:Olfr167	UTSW	16	19514836	missense	probably damaging	0.99
R1997:Olfr167	UTSW	16	19515042	missense	probably damaging	1.00
R2225:Olfr167	UTSW	16	19515246	missense	probably benign	0.05
R2226:Olfr167	UTSW	16	19515246	missense	probably benign	0.05
R4078:Olfr167	UTSW	16	19515232	missense	possibly damaging	0.76
R5019:Olfr167	UTSW	16	19515535	missense	probably damaging	0.99
R5071:Olfr167	UTSW	16	19515027	missense	probably benign	0.00
R5278:Olfr167	UTSW	16	19515378	nonsense	probably null
R5415:Olfr167	UTSW	16	19515246	missense	possibly damaging	0.94
R5744:Olfr167	UTSW	16	19515336	missense	probably benign	0.00
R5991:Olfr167	UTSW	16	19514757	missense	probably damaging	0.99
R6151:Olfr167	UTSW	16	19515531	missense	probably damaging	1.00
R6540:Olfr167	UTSW	16	19514821	missense	probably benign
R7014:Olfr167	UTSW	16	19515456	missense	probably benign	0.20
R7145:Olfr167	UTSW	16	19514899	missense	probably damaging	0.99
R7677:Olfr167	UTSW	16	19514928	missense	probably benign	0.42
R7715:Olfr167	UTSW	16	19514730	missense	probably benign	0.00
R7931:Olfr167	UTSW	16	19515508	missense	possibly damaging	0.94
R8137:Olfr167	UTSW	16	19515096	missense	possibly damaging	0.89
R8671:Olfr167	UTSW	16	19515054	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TAAGAGATCGATCCGAGTACTTAACC -3'
(R):5'- TCTACCGTATGCATTCTAGGGCG -3'

Sequencing Primer
(F):5'- CACGGAAGCAACTTGTCT -3'
(R):5'- TATGCATTCTAGGGCGGGGAAG -3'

Posted On

2019-10-17