Incidental Mutation 'R7535:Epg5'
ID 583556
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Name ectopic P-granules 5 autophagy tethering factor
Synonyms 5430411K18Rik
MMRRC Submission 045607-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.937) question?
Stock # R7535 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 77981680-78078228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78076141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 2513 (V2513E)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
AlphaFold Q80TA9
Predicted Effect probably benign
Transcript: ENSMUST00000044622
AA Change: V2513E

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: V2513E

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 79,837,463 (GRCm39) L449Q probably benign Het
Agtpbp1 T C 13: 59,652,067 (GRCm39) T415A probably benign Het
Akt3 A T 1: 176,924,600 (GRCm39) V165D probably damaging Het
Cbr2 T A 11: 120,620,628 (GRCm39) I219F probably damaging Het
Cdh20 T A 1: 104,902,768 (GRCm39) D486E probably damaging Het
Cenpe A G 3: 134,949,523 (GRCm39) S103G possibly damaging Het
Chd4 T A 6: 125,105,836 (GRCm39) S1818T probably benign Het
Chst5 T C 8: 112,616,795 (GRCm39) D275G probably damaging Het
Clca3a1 A G 3: 144,724,328 (GRCm39) I244T probably damaging Het
Cyp2c54 A G 19: 40,058,716 (GRCm39) Y239H probably benign Het
Czib T G 4: 107,752,097 (GRCm39) S159A probably benign Het
Ddx25 A G 9: 35,454,951 (GRCm39) F446L possibly damaging Het
Dgkb T C 12: 38,186,646 (GRCm39) L265P probably damaging Het
Dis3 A G 14: 99,327,415 (GRCm39) S363P probably benign Het
Disp3 T C 4: 148,327,323 (GRCm39) E1187G probably damaging Het
Dop1b G A 16: 93,603,249 (GRCm39) G2061R probably damaging Het
Dsp T C 13: 38,376,765 (GRCm39) S1517P probably benign Het
Fryl T A 5: 73,255,539 (GRCm39) T831S probably benign Het
Gm6309 A T 5: 146,105,100 (GRCm39) V271D probably damaging Het
H2-M2 G T 17: 37,793,528 (GRCm39) S159R probably benign Het
Helq A G 5: 100,937,999 (GRCm39) probably null Het
Herc1 G C 9: 66,382,135 (GRCm39) D3621H probably damaging Het
Hsd11b2 A T 8: 106,245,755 (GRCm39) I87F probably damaging Het
Ice2 A G 9: 69,339,360 (GRCm39) N959S probably damaging Het
Ifi47 T A 11: 48,987,452 (GRCm39) D406E probably damaging Het
Ifit3 T G 19: 34,565,280 (GRCm39) S275R probably damaging Het
Insl5 C A 4: 102,875,395 (GRCm39) K118N probably damaging Het
Irf7 A T 7: 140,844,550 (GRCm39) F158I probably benign Het
Kat2b T C 17: 53,931,431 (GRCm39) L143P probably damaging Het
Klk1b1 A T 7: 43,619,746 (GRCm39) N102Y probably damaging Het
Krt13 C T 11: 100,008,824 (GRCm39) G410S unknown Het
Larp6 A T 9: 60,631,437 (GRCm39) T70S probably benign Het
Lrrc37a T C 11: 103,392,683 (GRCm39) E914G possibly damaging Het
Mindy4 T C 6: 55,274,738 (GRCm39) probably null Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myom2 A G 8: 15,167,679 (GRCm39) Y1088C probably damaging Het
Mysm1 T C 4: 94,840,452 (GRCm39) N655D probably benign Het
Nbas T A 12: 13,329,390 (GRCm39) S112T probably damaging Het
Neb A G 2: 52,055,115 (GRCm39) probably null Het
Noxred1 G A 12: 87,280,206 (GRCm39) A42V probably benign Het
Olfm5 G A 7: 103,803,444 (GRCm39) P340S possibly damaging Het
Or11h4 G A 14: 50,974,122 (GRCm39) P166S probably benign Het
Or2l5 T C 16: 19,333,544 (GRCm39) T281A probably damaging Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Or5m8 T A 2: 85,822,245 (GRCm39) V28E probably benign Het
Or9i1b A G 19: 13,896,449 (GRCm39) K22E probably benign Het
Pccb A T 9: 100,876,615 (GRCm39) probably null Het
Pnn T A 12: 59,118,923 (GRCm39) V502E probably benign Het
Pole2 A T 12: 69,269,203 (GRCm39) I98K probably benign Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rasgrp4 A G 7: 28,838,484 (GRCm39) K111E probably benign Het
Rbbp6 G A 7: 122,589,366 (GRCm39) M351I probably benign Het
Rgs19 T G 2: 181,333,101 (GRCm39) H53P probably damaging Het
Rin1 A T 19: 5,102,564 (GRCm39) T369S probably benign Het
Rnaset2b G A 17: 7,259,138 (GRCm39) E135K possibly damaging Het
Rprd2 G A 3: 95,683,899 (GRCm39) P379S probably damaging Het
Sbno1 A G 5: 124,551,342 (GRCm39) L47P possibly damaging Het
Slamf6 T A 1: 171,747,325 (GRCm39) L29Q unknown Het
Slc16a14 T C 1: 84,890,843 (GRCm39) Y154C probably damaging Het
Slc22a29 A G 19: 8,147,342 (GRCm39) F340S probably damaging Het
Slc6a4 T G 11: 76,905,976 (GRCm39) I259S possibly damaging Het
Smarca4 G A 9: 21,558,921 (GRCm39) V651I possibly damaging Het
Susd5 C T 9: 113,893,108 (GRCm39) A62V possibly damaging Het
Syt1 T A 10: 108,463,283 (GRCm39) probably null Het
Taf10 T C 7: 105,390,117 (GRCm39) I218T probably benign Het
Tas1r1 C A 4: 152,112,819 (GRCm39) V745F probably benign Het
Tas2r125 C A 6: 132,887,287 (GRCm39) T225K probably damaging Het
Tcp11l2 G T 10: 84,430,523 (GRCm39) R216L possibly damaging Het
Tnks1bp1 C T 2: 84,893,624 (GRCm39) Q1184* probably null Het
Treml2 T A 17: 48,609,847 (GRCm39) V93D probably damaging Het
Trim11 G A 11: 58,872,891 (GRCm39) E192K probably damaging Het
Trim43a A G 9: 88,470,201 (GRCm39) K336E probably damaging Het
Tspan33 T A 6: 29,717,588 (GRCm39) I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 (GRCm39) C458Y probably damaging Het
Ttc6 A G 12: 57,623,305 (GRCm39) S235G probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Usp36 A T 11: 118,152,872 (GRCm39) S1084T possibly damaging Het
Vps39 T A 2: 120,155,176 (GRCm39) N550I probably damaging Het
Wdr47 A G 3: 108,537,027 (GRCm39) I572V probably benign Het
Zfp112 A T 7: 23,826,135 (GRCm39) Y705F probably damaging Het
Zfp282 A G 6: 47,881,878 (GRCm39) T522A probably benign Het
Zfp292 T C 4: 34,811,487 (GRCm39) D524G probably benign Het
Zfp90 A T 8: 107,150,900 (GRCm39) K204N possibly damaging Het
Zmym2 T C 14: 57,194,536 (GRCm39) S1265P probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78,055,956 (GRCm39) missense probably damaging 1.00
IGL01778:Epg5 APN 18 78,062,489 (GRCm39) missense probably damaging 0.98
IGL01936:Epg5 APN 18 78,028,316 (GRCm39) missense probably damaging 1.00
IGL02189:Epg5 APN 18 78,056,085 (GRCm39) missense probably damaging 0.99
IGL02323:Epg5 APN 18 78,056,047 (GRCm39) nonsense probably null
IGL02567:Epg5 APN 18 78,076,288 (GRCm39) missense probably damaging 1.00
IGL02805:Epg5 APN 18 78,073,406 (GRCm39) splice site probably benign
IGL03282:Epg5 APN 18 78,029,641 (GRCm39) missense probably benign 0.25
stitch UTSW 18 77,991,514 (GRCm39) nonsense probably null
R0011:Epg5 UTSW 18 77,991,698 (GRCm39) missense probably benign
R0172:Epg5 UTSW 18 78,070,574 (GRCm39) missense probably benign 0.00
R0335:Epg5 UTSW 18 78,029,687 (GRCm39) missense probably benign 0.25
R0380:Epg5 UTSW 18 78,004,056 (GRCm39) missense probably damaging 1.00
R0441:Epg5 UTSW 18 78,066,486 (GRCm39) splice site probably benign
R0443:Epg5 UTSW 18 77,999,118 (GRCm39) splice site probably benign
R0445:Epg5 UTSW 18 78,057,399 (GRCm39) missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78,066,580 (GRCm39) missense probably damaging 1.00
R0892:Epg5 UTSW 18 78,011,843 (GRCm39) missense possibly damaging 0.94
R1081:Epg5 UTSW 18 78,002,748 (GRCm39) missense possibly damaging 0.92
R1183:Epg5 UTSW 18 78,003,926 (GRCm39) missense probably damaging 1.00
R1374:Epg5 UTSW 18 78,024,541 (GRCm39) missense probably benign
R1428:Epg5 UTSW 18 78,005,642 (GRCm39) missense probably damaging 1.00
R1727:Epg5 UTSW 18 78,059,030 (GRCm39) missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78,067,205 (GRCm39) missense probably damaging 0.99
R1801:Epg5 UTSW 18 78,026,705 (GRCm39) missense possibly damaging 0.63
R1864:Epg5 UTSW 18 78,018,246 (GRCm39) missense probably damaging 0.99
R1908:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1909:Epg5 UTSW 18 78,002,247 (GRCm39) missense probably benign 0.26
R1916:Epg5 UTSW 18 78,008,236 (GRCm39) missense probably benign 0.00
R1986:Epg5 UTSW 18 78,025,521 (GRCm39) critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78,067,202 (GRCm39) missense probably damaging 0.98
R2080:Epg5 UTSW 18 77,991,960 (GRCm39) missense probably benign 0.01
R2106:Epg5 UTSW 18 78,034,578 (GRCm39) nonsense probably null
R2144:Epg5 UTSW 18 77,997,412 (GRCm39) missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78,070,517 (GRCm39) missense probably benign
R2217:Epg5 UTSW 18 77,992,287 (GRCm39) missense probably benign
R2424:Epg5 UTSW 18 78,011,828 (GRCm39) missense probably benign 0.05
R2909:Epg5 UTSW 18 78,026,691 (GRCm39) missense probably damaging 1.00
R3725:Epg5 UTSW 18 78,060,894 (GRCm39) missense probably benign 0.00
R3899:Epg5 UTSW 18 78,000,725 (GRCm39) missense probably damaging 1.00
R4019:Epg5 UTSW 18 78,073,665 (GRCm39) missense probably damaging 0.98
R4260:Epg5 UTSW 18 78,058,914 (GRCm39) missense probably damaging 1.00
R4260:Epg5 UTSW 18 78,002,336 (GRCm39) missense possibly damaging 0.50
R4448:Epg5 UTSW 18 78,005,676 (GRCm39) missense probably damaging 1.00
R4475:Epg5 UTSW 18 77,991,723 (GRCm39) missense probably benign
R4612:Epg5 UTSW 18 78,025,629 (GRCm39) missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78,056,079 (GRCm39) missense probably benign 0.45
R4767:Epg5 UTSW 18 78,066,498 (GRCm39) missense possibly damaging 0.67
R4779:Epg5 UTSW 18 78,034,580 (GRCm39) missense probably benign 0.01
R4791:Epg5 UTSW 18 77,992,211 (GRCm39) nonsense probably null
R4797:Epg5 UTSW 18 78,073,614 (GRCm39) missense probably benign 0.00
R4812:Epg5 UTSW 18 78,022,399 (GRCm39) missense probably benign 0.01
R4899:Epg5 UTSW 18 78,028,272 (GRCm39) missense probably damaging 1.00
R5000:Epg5 UTSW 18 77,997,376 (GRCm39) missense probably benign
R5031:Epg5 UTSW 18 78,072,163 (GRCm39) missense probably benign 0.00
R5050:Epg5 UTSW 18 78,019,156 (GRCm39) missense possibly damaging 0.55
R5114:Epg5 UTSW 18 78,038,828 (GRCm39) missense probably benign
R5144:Epg5 UTSW 18 78,058,895 (GRCm39) missense probably damaging 1.00
R5209:Epg5 UTSW 18 77,994,497 (GRCm39) missense probably damaging 1.00
R5213:Epg5 UTSW 18 78,058,049 (GRCm39) missense probably benign 0.01
R5270:Epg5 UTSW 18 78,026,778 (GRCm39) missense possibly damaging 0.79
R5324:Epg5 UTSW 18 78,005,660 (GRCm39) missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78,070,712 (GRCm39) missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77,994,422 (GRCm39) missense possibly damaging 0.81
R5593:Epg5 UTSW 18 78,000,689 (GRCm39) missense probably damaging 1.00
R5718:Epg5 UTSW 18 78,029,618 (GRCm39) missense probably damaging 1.00
R5773:Epg5 UTSW 18 78,004,040 (GRCm39) missense probably damaging 1.00
R5828:Epg5 UTSW 18 78,064,066 (GRCm39) missense probably damaging 0.99
R5847:Epg5 UTSW 18 78,073,270 (GRCm39) missense probably benign 0.06
R5858:Epg5 UTSW 18 77,991,514 (GRCm39) nonsense probably null
R5914:Epg5 UTSW 18 78,002,847 (GRCm39) critical splice donor site probably null
R6124:Epg5 UTSW 18 78,073,260 (GRCm39) missense probably benign
R6228:Epg5 UTSW 18 77,991,677 (GRCm39) missense possibly damaging 0.90
R6252:Epg5 UTSW 18 78,028,382 (GRCm39) missense probably damaging 1.00
R6269:Epg5 UTSW 18 77,991,585 (GRCm39) missense probably benign
R6312:Epg5 UTSW 18 78,022,426 (GRCm39) missense possibly damaging 0.72
R6320:Epg5 UTSW 18 78,005,613 (GRCm39) missense probably damaging 1.00
R6328:Epg5 UTSW 18 78,072,179 (GRCm39) missense possibly damaging 0.88
R6430:Epg5 UTSW 18 78,019,100 (GRCm39) missense probably damaging 1.00
R6458:Epg5 UTSW 18 77,991,469 (GRCm39) missense probably benign 0.03
R6852:Epg5 UTSW 18 78,056,106 (GRCm39) missense probably damaging 1.00
R6915:Epg5 UTSW 18 78,022,380 (GRCm39) missense probably benign 0.00
R6930:Epg5 UTSW 18 78,057,378 (GRCm39) missense probably damaging 0.99
R6932:Epg5 UTSW 18 77,991,824 (GRCm39) missense probably benign 0.00
R7127:Epg5 UTSW 18 78,072,140 (GRCm39) missense probably damaging 1.00
R7207:Epg5 UTSW 18 77,992,170 (GRCm39) missense probably damaging 1.00
R7225:Epg5 UTSW 18 78,055,917 (GRCm39) missense probably benign 0.45
R7358:Epg5 UTSW 18 78,002,252 (GRCm39) missense possibly damaging 0.78
R7414:Epg5 UTSW 18 78,026,747 (GRCm39) missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78,066,493 (GRCm39) missense probably benign 0.01
R7586:Epg5 UTSW 18 78,073,275 (GRCm39) missense probably benign
R7651:Epg5 UTSW 18 78,024,615 (GRCm39) nonsense probably null
R7715:Epg5 UTSW 18 78,011,801 (GRCm39) missense probably damaging 1.00
R7753:Epg5 UTSW 18 77,991,560 (GRCm39) missense possibly damaging 0.92
R7981:Epg5 UTSW 18 78,052,929 (GRCm39) critical splice donor site probably null
R8114:Epg5 UTSW 18 78,073,365 (GRCm39) missense probably benign 0.41
R8124:Epg5 UTSW 18 78,008,211 (GRCm39) missense probably benign 0.05
R8307:Epg5 UTSW 18 78,065,894 (GRCm39) missense probably damaging 1.00
R8458:Epg5 UTSW 18 77,991,946 (GRCm39) missense probably benign 0.00
R8751:Epg5 UTSW 18 78,008,225 (GRCm39) missense probably benign 0.28
R8751:Epg5 UTSW 18 78,008,224 (GRCm39) missense possibly damaging 0.65
R8751:Epg5 UTSW 18 78,008,223 (GRCm39) missense probably benign 0.07
R8888:Epg5 UTSW 18 78,056,086 (GRCm39) missense possibly damaging 0.76
R8971:Epg5 UTSW 18 78,022,434 (GRCm39) missense probably damaging 1.00
R9045:Epg5 UTSW 18 77,992,014 (GRCm39) missense probably damaging 1.00
R9291:Epg5 UTSW 18 78,056,065 (GRCm39) nonsense probably null
R9327:Epg5 UTSW 18 77,991,435 (GRCm39) missense probably benign 0.00
R9365:Epg5 UTSW 18 77,997,957 (GRCm39) missense probably damaging 1.00
R9742:Epg5 UTSW 18 78,024,170 (GRCm39) missense probably damaging 1.00
X0023:Epg5 UTSW 18 78,011,872 (GRCm39) missense probably damaging 0.99
X0060:Epg5 UTSW 18 78,005,700 (GRCm39) missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 78,002,354 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACTAGCCTGGCATGGAAAGG -3'
(R):5'- GTCCAGGTAATGCACTTCTGG -3'

Sequencing Primer
(F):5'- TGTAATGAGATCTGACGCCC -3'
(R):5'- TCCAGGTAATGCACTTCTGGATAGAG -3'
Posted On 2019-10-17