Incidental Mutation 'R7535:Slc22a29'
ID583558
Institutional Source Beutler Lab
Gene Symbol Slc22a29
Ensembl Gene ENSMUSG00000075044
Gene Namesolute carrier family 22. member 29
SynonymsD630002G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7535 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8160165-8218900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8169978 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 340 (F340S)
Ref Sequence ENSEMBL: ENSMUSP00000108923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113298] [ENSMUST00000222533]
Predicted Effect probably damaging
Transcript: ENSMUST00000113298
AA Change: F340S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108923
Gene: ENSMUSG00000075044
AA Change: F340S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.3e-25 PFAM
Pfam:MFS_1 140 372 7.7e-14 PFAM
Pfam:MFS_1 348 549 6.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000222533
AA Change: F340S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T G 4: 107,894,900 S159A probably benign Het
Abca7 T A 10: 80,001,629 L449Q probably benign Het
Agtpbp1 T C 13: 59,504,253 T415A probably benign Het
Akt3 A T 1: 177,097,034 V165D probably damaging Het
Cbr2 T A 11: 120,729,802 I219F probably damaging Het
Cdh20 T A 1: 104,975,043 D486E probably damaging Het
Cenpe A G 3: 135,243,762 S103G possibly damaging Het
Chd4 T A 6: 125,128,873 S1818T probably benign Het
Chst5 T C 8: 111,890,163 D275G probably damaging Het
Clca1 A G 3: 145,018,567 I244T probably damaging Het
Cyp2c54 A G 19: 40,070,272 Y239H probably benign Het
Ddx25 A G 9: 35,543,655 F446L possibly damaging Het
Dgkb T C 12: 38,136,647 L265P probably damaging Het
Dis3 A G 14: 99,089,979 S363P probably benign Het
Disp3 T C 4: 148,242,866 E1187G probably damaging Het
Dopey2 G A 16: 93,806,361 G2061R probably damaging Het
Dsp T C 13: 38,192,789 S1517P probably benign Het
Epg5 T A 18: 78,032,926 V2513E probably benign Het
Fryl T A 5: 73,098,196 T831S probably benign Het
Gm6309 A T 5: 146,168,290 V271D probably damaging Het
H2-M2 G T 17: 37,482,637 S159R probably benign Het
Helq A G 5: 100,790,133 probably null Het
Herc1 G C 9: 66,474,853 D3621H probably damaging Het
Hsd11b2 A T 8: 105,519,123 I87F probably damaging Het
Ice2 A G 9: 69,432,078 N959S probably damaging Het
Ifi47 T A 11: 49,096,625 D406E probably damaging Het
Ifit3 T G 19: 34,587,880 S275R probably damaging Het
Insl5 C A 4: 103,018,198 K118N probably damaging Het
Irf7 A T 7: 141,264,637 F158I probably benign Het
Kat2b T C 17: 53,624,403 L143P probably damaging Het
Klk1b1 A T 7: 43,970,322 N102Y probably damaging Het
Krt13 C T 11: 100,117,998 G410S unknown Het
Larp6 A T 9: 60,724,154 T70S probably benign Het
Lrrc37a T C 11: 103,501,857 E914G possibly damaging Het
Mindy4 T C 6: 55,297,753 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myom2 A G 8: 15,117,679 Y1088C probably damaging Het
Mysm1 T C 4: 94,952,215 N655D probably benign Het
Nbas T A 12: 13,279,389 S112T probably damaging Het
Neb A G 2: 52,165,103 probably null Het
Noxred1 G A 12: 87,233,432 A42V probably benign Het
Olfm5 G A 7: 104,154,237 P340S possibly damaging Het
Olfr1031 T A 2: 85,991,901 V28E probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr1505 A G 19: 13,919,085 K22E probably benign Het
Olfr167 T C 16: 19,514,794 T281A probably damaging Het
Olfr749 G A 14: 50,736,665 P166S probably benign Het
Pccb A T 9: 100,994,562 probably null Het
Pnn T A 12: 59,072,137 V502E probably benign Het
Pole2 A T 12: 69,222,429 I98K probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rasgrp4 A G 7: 29,139,059 K111E probably benign Het
Rbbp6 G A 7: 122,990,143 M351I probably benign Het
Rgs19 T G 2: 181,691,308 H53P probably damaging Het
Rin1 A T 19: 5,052,536 T369S probably benign Het
Rnaset2b G A 17: 6,991,739 E135K possibly damaging Het
Rprd2 G A 3: 95,776,587 P379S probably damaging Het
Sbno1 A G 5: 124,413,279 L47P possibly damaging Het
Slamf6 T A 1: 171,919,758 L29Q unknown Het
Slc16a14 T C 1: 84,913,122 Y154C probably damaging Het
Slc6a4 T G 11: 77,015,150 I259S possibly damaging Het
Smarca4 G A 9: 21,647,625 V651I possibly damaging Het
Susd5 C T 9: 114,064,040 A62V possibly damaging Het
Syt1 T A 10: 108,627,422 probably null Het
Taf10 T C 7: 105,740,910 I218T probably benign Het
Tas1r1 C A 4: 152,028,362 V745F probably benign Het
Tas2r125 C A 6: 132,910,324 T225K probably damaging Het
Tcp11l2 G T 10: 84,594,659 R216L possibly damaging Het
Tnks1bp1 C T 2: 85,063,280 Q1184* probably null Het
Treml2 T A 17: 48,302,819 V93D probably damaging Het
Trim11 G A 11: 58,982,065 E192K probably damaging Het
Trim43a A G 9: 88,588,148 K336E probably damaging Het
Tspan33 T A 6: 29,717,589 I268N possibly damaging Het
Tstd2 C T 4: 46,116,960 C458Y probably damaging Het
Ttc6 A G 12: 57,576,519 S235G probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Usp36 A T 11: 118,262,046 S1084T possibly damaging Het
Vps39 T A 2: 120,324,695 N550I probably damaging Het
Wdr47 A G 3: 108,629,711 I572V probably benign Het
Zfp112 A T 7: 24,126,710 Y705F probably damaging Het
Zfp282 A G 6: 47,904,944 T522A probably benign Het
Zfp292 T C 4: 34,811,487 D524G probably benign Het
Zfp90 A T 8: 106,424,268 K204N possibly damaging Het
Zmym2 T C 14: 56,957,079 S1265P probably damaging Het
Other mutations in Slc22a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc22a29 APN 19 8217813 missense probably benign 0.44
IGL00562:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00563:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00952:Slc22a29 APN 19 8217857 missense probably damaging 1.00
IGL01526:Slc22a29 APN 19 8207178 splice site probably benign
IGL01792:Slc22a29 APN 19 8218529 missense probably damaging 1.00
IGL02191:Slc22a29 APN 19 8218681 unclassified probably benign
IGL02391:Slc22a29 APN 19 8169353 missense probably benign 0.13
IGL02408:Slc22a29 APN 19 8207285 missense probably benign 0.00
IGL02957:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03059:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03299:Slc22a29 APN 19 8162648 critical splice donor site probably null
IGL03368:Slc22a29 APN 19 8207262 critical splice donor site probably null
R0017:Slc22a29 UTSW 19 8218266 splice site probably benign
R0105:Slc22a29 UTSW 19 8160627 unclassified probably benign
R0157:Slc22a29 UTSW 19 8162742 missense possibly damaging 0.61
R0265:Slc22a29 UTSW 19 8169970 missense probably benign 0.18
R1758:Slc22a29 UTSW 19 8217762 critical splice donor site probably null
R1918:Slc22a29 UTSW 19 8217759 splice site probably null
R1927:Slc22a29 UTSW 19 8207066 missense probably benign 0.01
R1959:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1960:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1961:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1966:Slc22a29 UTSW 19 8218408 missense probably damaging 1.00
R1968:Slc22a29 UTSW 19 8218343 missense probably benign 0.27
R1997:Slc22a29 UTSW 19 8217798 missense probably benign 0.00
R3105:Slc22a29 UTSW 19 8169973 missense probably benign 0.25
R3725:Slc22a29 UTSW 19 8218609 missense possibly damaging 0.78
R4118:Slc22a29 UTSW 19 8160529 unclassified probably benign
R4465:Slc22a29 UTSW 19 8162724 nonsense probably null
R4584:Slc22a29 UTSW 19 8169291 missense probably benign 0.02
R4656:Slc22a29 UTSW 19 8218300 missense possibly damaging 0.90
R4679:Slc22a29 UTSW 19 8161584 missense possibly damaging 0.65
R4899:Slc22a29 UTSW 19 8161569 missense probably benign 0.00
R4913:Slc22a29 UTSW 19 8218358 missense probably benign 0.17
R5119:Slc22a29 UTSW 19 8217830 missense probably damaging 0.99
R5470:Slc22a29 UTSW 19 8161516 missense probably benign 0.01
R5474:Slc22a29 UTSW 19 8217857 missense probably damaging 1.00
R6794:Slc22a29 UTSW 19 8161523 missense probably benign 0.06
R6798:Slc22a29 UTSW 19 8160604 missense probably benign 0.16
R7025:Slc22a29 UTSW 19 8160580 missense probably benign
R7240:Slc22a29 UTSW 19 8161511 missense probably damaging 0.98
R7846:Slc22a29 UTSW 19 8193487 missense probably benign 0.39
R7929:Slc22a29 UTSW 19 8193487 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CCTCACTGCACAGTAAGTTCC -3'
(R):5'- CTGTAGAAATCCCCTGAGTGTC -3'

Sequencing Primer
(F):5'- TCACTGCACAGTAAGTTCCATATAC -3'
(R):5'- AGAAATCCCCTGAGTGTCTTTTTG -3'
Posted On2019-10-17