Incidental Mutation 'R0616:Snap29'
ID58358
Institutional Source Beutler Lab
Gene Symbol Snap29
Ensembl Gene ENSMUSG00000022765
Gene Namesynaptosomal-associated protein 29
Synonyms1300018G05Rik
MMRRC Submission 038805-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0616 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17405986-17430827 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 17422506 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 159 (K159*)
Ref Sequence ENSEMBL: ENSMUSP00000023449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023449]
Predicted Effect probably null
Transcript: ENSMUST00000023449
AA Change: K159*
SMART Domains Protein: ENSMUSP00000023449
Gene: ENSMUSG00000022765
AA Change: K159*

DomainStartEndE-ValueType
t_SNARE 45 112 1.53e-6 SMART
t_SNARE 193 260 1.39e-13 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the SNAP25 gene family, encodes a protein involved in multiple membrane trafficking steps. Two other members of this gene family, SNAP23 and SNAP25, encode proteins that bind a syntaxin protein and mediate synaptic vesicle membrane docking and fusion to the plasma membrane. The protein encoded by this gene binds tightly to multiple syntaxins and is localized to intracellular membrane structures rather than to the plasma membrane. While the protein is mostly membrane-bound, a significant fraction of it is found free in the cytoplasm. Use of multiple polyadenylation sites has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slightly reduced birth body size and a congenital ichtyotic phenotype associated with scaly and tight skin, hyperkeratosis, acanthosis, abnormalities in epidermal differentiation and autophagy, and increased endoplasmic reticulum stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,773,656 T198K possibly damaging Het
Abca12 G T 1: 71,302,671 Q1044K probably damaging Het
Abi3bp A T 16: 56,654,070 T723S probably damaging Het
Ackr3 G A 1: 90,214,469 V217I probably benign Het
Acnat2 A G 4: 49,380,269 S370P probably damaging Het
Arap1 A G 7: 101,401,650 R1152G possibly damaging Het
Arhgap15 G A 2: 44,116,717 probably null Het
Arhgap5 C T 12: 52,517,065 T273I possibly damaging Het
BC017158 A T 7: 128,272,631 probably null Het
C1s2 T C 6: 124,628,764 E332G probably damaging Het
Camp G A 9: 109,848,639 R88W probably benign Het
Cdkl2 A G 5: 92,009,004 M564T probably benign Het
Ceacam20 A G 7: 19,970,396 H124R probably benign Het
Cep19 C T 16: 32,104,011 R32C probably damaging Het
Cep295 G A 9: 15,332,322 Q1565* probably null Het
Chd3 T C 11: 69,345,487 E1932G probably damaging Het
Cnr2 G T 4: 135,917,562 W317L probably benign Het
Cntnap5a C T 1: 116,580,549 H1264Y possibly damaging Het
Depdc7 T A 2: 104,727,305 N200I probably benign Het
Dock4 T C 12: 40,704,415 S468P probably benign Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Fam126a T C 5: 23,986,772 T44A probably damaging Het
Fam217a C A 13: 34,913,683 S55I probably benign Het
Fam92a G A 4: 12,168,234 R210* probably null Het
Farp1 G A 14: 121,277,022 R921H probably damaging Het
Fat4 A G 3: 38,942,870 D1746G probably damaging Het
Fbxw5 T C 2: 25,502,505 F100L probably damaging Het
Gli3 C A 13: 15,662,406 T458K possibly damaging Het
Gm4841 T C 18: 60,270,937 Y28C probably benign Het
Gprc5d T C 6: 135,116,432 E159G probably benign Het
Grm4 A T 17: 27,434,564 I757N probably damaging Het
Hagh A G 17: 24,857,577 Y94C probably damaging Het
Itpkb T C 1: 180,421,736 I892T probably damaging Het
Kcmf1 T C 6: 72,850,484 I58V probably benign Het
Khdrbs2 A G 1: 32,467,775 I167V possibly damaging Het
Kmt2c A G 5: 25,299,252 I275T probably benign Het
Lingo4 A G 3: 94,403,081 K442R probably benign Het
Mak T C 13: 41,042,185 N382D probably benign Het
Maob G A X: 16,710,163 T480I possibly damaging Het
Mcoln1 A G 8: 3,515,025 E573G probably benign Het
Ms4a6b G A 19: 11,526,898 probably null Het
Muc5ac A G 7: 141,796,244 M576V probably benign Het
Nme8 T A 13: 19,690,859 D126V probably benign Het
Npy2r T A 3: 82,541,363 D35V possibly damaging Het
Nrxn1 T C 17: 90,362,857 D193G probably damaging Het
Olfr1257 T A 2: 89,881,591 V255E probably benign Het
Olfr130 A C 17: 38,067,240 E23A probably damaging Het
Olfr1391 T C 11: 49,327,756 L115P probably damaging Het
Olfr1537 G A 9: 39,237,650 T258M probably benign Het
Olfr214 A G 6: 116,556,928 I168V probably benign Het
Olfr548-ps1 T A 7: 102,542,554 M206K possibly damaging Het
Olfr895 G T 9: 38,269,334 V266L probably benign Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Olfr984 A T 9: 40,100,987 F168I probably damaging Het
Pabpc2 A T 18: 39,773,739 H19L possibly damaging Het
Pcdhb9 A T 18: 37,401,975 K341* probably null Het
Pde4dip T C 3: 97,747,533 I859M probably benign Het
Pfkfb2 T C 1: 130,706,422 probably null Het
Pigg C T 5: 108,314,085 T94M probably damaging Het
Pik3c2b T C 1: 133,100,831 F1353L probably damaging Het
Prg4 T C 1: 150,460,711 D87G probably damaging Het
Prkdc A T 16: 15,690,407 D974V probably damaging Het
Prmt3 A G 7: 49,787,328 Y217C probably damaging Het
Proser1 A G 3: 53,474,697 T192A probably damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Rb1cc1 A G 1: 6,244,262 K386R possibly damaging Het
Rcn2 A G 9: 56,056,250 D221G probably benign Het
Rhbdl3 T G 11: 80,331,861 H245Q probably damaging Het
Ribc1 T C X: 152,005,791 E204G probably damaging Het
Rpap1 G A 2: 119,778,120 L254F probably damaging Het
Rrp12 A G 19: 41,892,549 F148L possibly damaging Het
Setdb1 A T 3: 95,341,798 I333K probably damaging Het
Simc1 A G 13: 54,547,032 I1210V probably benign Het
Smchd1 T A 17: 71,379,574 D1379V probably benign Het
Spdye4c A T 2: 128,594,212 K176M possibly damaging Het
Stk31 T A 6: 49,423,485 W415R probably damaging Het
Supt6 C T 11: 78,209,495 R1497Q probably damaging Het
Tenm3 A G 8: 48,276,156 I1605T possibly damaging Het
Ttn T C 2: 76,846,623 probably null Het
Ttn A G 2: 76,897,667 probably benign Het
Ucp3 A T 7: 100,480,161 T68S probably benign Het
Ugt2b36 T C 5: 87,089,477 N316D probably benign Het
Usp4 T G 9: 108,366,804 S247A probably benign Het
Utp20 A T 10: 88,770,751 V1653D probably benign Het
Vmn1r183 A G 7: 24,054,825 I18V probably benign Het
Vmn1r237 A G 17: 21,314,623 M203V probably damaging Het
Vmn1r61 A T 7: 5,610,999 F105L possibly damaging Het
Zfp462 T C 4: 55,011,951 C158R probably damaging Het
Zfyve16 C G 13: 92,521,129 R758P probably damaging Het
Other mutations in Snap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03231:Snap29 APN 16 17427100 missense probably benign 0.06
IGL02799:Snap29 UTSW 16 17422503 missense probably benign
R0086:Snap29 UTSW 16 17428236 missense probably damaging 0.96
R0371:Snap29 UTSW 16 17406203 missense probably benign 0.02
R0709:Snap29 UTSW 16 17406148 missense probably damaging 0.99
R2002:Snap29 UTSW 16 17406326 nonsense probably null
R2137:Snap29 UTSW 16 17428249 missense possibly damaging 0.60
R4478:Snap29 UTSW 16 17428155 missense probably benign 0.00
R4976:Snap29 UTSW 16 17419268 missense probably damaging 1.00
R5933:Snap29 UTSW 16 17406330 missense probably damaging 1.00
R6314:Snap29 UTSW 16 17419319 missense probably benign 0.25
R6824:Snap29 UTSW 16 17422506 missense probably benign 0.01
R7397:Snap29 UTSW 16 17419372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTGGCTATGCAGCACAAAGG -3'
(R):5'- ACTGAGGTAGAAGGAACCCCACTG -3'

Sequencing Primer
(F):5'- CAGCACAAAGGGATCATGGG -3'
(R):5'- GAAACATATGCCTATGGTTCCC -3'
Posted On2013-07-11