Incidental Mutation 'R7536:Ttc39b'
ID583580
Institutional Source Beutler Lab
Gene Symbol Ttc39b
Ensembl Gene ENSMUSG00000038172
Gene Nametetratricopeptide repeat domain 39B
Synonyms9130422G05Rik, 1810054D07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7536 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location83220300-83324255 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 83239978 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 503 (Y503*)
Ref Sequence ENSEMBL: ENSMUSP00000040590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048274] [ENSMUST00000102823]
Predicted Effect probably null
Transcript: ENSMUST00000048274
AA Change: Y503*
SMART Domains Protein: ENSMUSP00000040590
Gene: ENSMUSG00000038172
AA Change: Y503*

DomainStartEndE-ValueType
Pfam:DUF3808 75 478 2.2e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102823
SMART Domains Protein: ENSMUSP00000099887
Gene: ENSMUSG00000038172

DomainStartEndE-ValueType
Pfam:DUF3808 75 533 3.6e-167 PFAM
Pfam:TPR_8 329 360 4.5e-3 PFAM
Pfam:TPR_6 563 594 6.9e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,742 V755M probably damaging Het
3632451O06Rik G T 14: 49,774,246 probably null Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
AI597479 C G 1: 43,111,345 A205G possibly damaging Het
Akr1c14 T A 13: 4,063,690 V74E probably damaging Het
Bbs9 A T 9: 22,670,800 Q596L probably damaging Het
Bub3 A G 7: 131,568,703 D318G probably damaging Het
Cela1 A G 15: 100,675,364 V248A probably damaging Het
Cer1 C A 4: 82,884,968 R39L probably benign Het
Clec16a A G 16: 10,638,844 T624A possibly damaging Het
Coro1c C A 5: 113,845,289 G393W probably damaging Het
Crym A G 7: 120,201,108 L97P probably damaging Het
Cyp2a5 T G 7: 26,840,478 L317R probably damaging Het
Cyp2j6 C A 4: 96,535,537 G198V probably damaging Het
Dnajb6 A G 5: 29,757,806 E238G possibly damaging Het
Dnhd1 C A 7: 105,709,561 T3419K probably damaging Het
Dpep3 A T 8: 105,977,400 I262K probably damaging Het
Dscam T G 16: 96,641,026 probably null Het
Farsb A G 1: 78,443,754 V500A possibly damaging Het
Fbxl20 A T 11: 98,095,383 C136* probably null Het
Fbxo43 G T 15: 36,161,851 D403E probably benign Het
Frem1 A G 4: 82,956,195 S1397P probably damaging Het
Fut8 A G 12: 77,475,078 Y497C probably damaging Het
Gbp3 A T 3: 142,566,395 R219S probably damaging Het
Gm14295 T A 2: 176,810,929 H737Q possibly damaging Het
Gpr89 C A 3: 96,890,893 R149L probably damaging Het
Greb1 A T 12: 16,682,185 Y1592N probably damaging Het
Gria4 A C 9: 4,464,298 Y555D probably damaging Het
Hspa1b T A 17: 34,958,875 T45S possibly damaging Het
Kif5b A T 18: 6,216,235 N571K probably benign Het
Mapkbp1 T A 2: 120,018,585 M694K probably damaging Het
Med24 G A 11: 98,712,621 H439Y possibly damaging Het
Mgl2 G T 11: 70,137,007 R347L probably benign Het
Mms22l T A 4: 24,581,240 L850Q probably damaging Het
Mrpl51 T C 6: 125,192,567 V44A possibly damaging Het
Mylk3 T C 8: 85,353,604 I485V probably benign Het
Olfr1116 C T 2: 87,269,599 Q273* probably null Het
Olfr868 C A 9: 20,101,530 T257K probably damaging Het
Pde4dip A G 3: 97,757,244 L434P probably damaging Het
Pla2g4a T C 1: 149,880,017 Y223C probably damaging Het
Plcl1 C T 1: 55,713,481 Q995* probably null Het
Pls1 C T 9: 95,762,057 C462Y probably damaging Het
Ppp6r3 T C 19: 3,507,341 E249G possibly damaging Het
Prb1 T A 6: 132,207,221 N483I unknown Het
R3hdm1 A G 1: 128,182,211 probably null Het
Rasgrp3 T C 17: 75,514,133 F445S probably damaging Het
Rnf39 G T 17: 36,943,117 L10F probably damaging Het
Rnh1 T C 7: 141,160,812 D410G possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh3bp2 A G 5: 34,543,557 T35A probably benign Het
Skint6 T A 4: 112,811,547 probably null Het
Slc13a1 A T 6: 24,100,331 D384E probably damaging Het
Slc27a6 A G 18: 58,556,626 T55A probably damaging Het
Slc46a2 G A 4: 59,914,141 Q261* probably null Het
St7 C G 6: 17,886,020 P327R probably damaging Het
Stx1a T C 5: 135,049,840 I268T probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmem144 A T 3: 79,827,657 N151K probably benign Het
Tmem145 T C 7: 25,307,869 S171P probably damaging Het
Traf2 A G 2: 25,537,106 Y78H possibly damaging Het
Tsc22d1 A G 14: 76,504,763 Y16C probably benign Het
Ttn T C 2: 76,717,337 D32163G probably benign Het
Uba6 A T 5: 86,124,332 S833T probably benign Het
Wdtc1 A G 4: 133,295,250 L595P probably damaging Het
Other mutations in Ttc39b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Ttc39b APN 4 83244039 splice site probably benign
IGL02118:Ttc39b APN 4 83297949 missense probably damaging 1.00
IGL02860:Ttc39b APN 4 83263746 missense probably benign 0.14
IGL03008:Ttc39b APN 4 83247695 missense probably benign 0.00
IGL03136:Ttc39b APN 4 83237280 missense probably damaging 0.97
IGL03310:Ttc39b APN 4 83247659 missense probably benign 0.00
IGL03409:Ttc39b APN 4 83260956 missense probably damaging 1.00
R0536:Ttc39b UTSW 4 83227198 missense probably damaging 1.00
R0654:Ttc39b UTSW 4 83241701 missense probably benign 0.03
R1690:Ttc39b UTSW 4 83227177 missense probably damaging 1.00
R1758:Ttc39b UTSW 4 83237349 missense probably damaging 1.00
R1933:Ttc39b UTSW 4 83232720 missense possibly damaging 0.87
R2221:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R2223:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R4182:Ttc39b UTSW 4 83237301 missense probably damaging 1.00
R4746:Ttc39b UTSW 4 83244103 missense probably benign 0.01
R4984:Ttc39b UTSW 4 83242209 missense probably benign 0.05
R5328:Ttc39b UTSW 4 83261941 missense probably damaging 1.00
R5360:Ttc39b UTSW 4 83261847 missense probably damaging 1.00
R5429:Ttc39b UTSW 4 83243953 missense possibly damaging 0.50
R5646:Ttc39b UTSW 4 83244070 missense probably damaging 1.00
R6353:Ttc39b UTSW 4 83230493 missense probably benign 0.07
R6681:Ttc39b UTSW 4 83240048 intron probably benign
R6873:Ttc39b UTSW 4 83246276 missense probably damaging 1.00
R7274:Ttc39b UTSW 4 83261851 missense possibly damaging 0.95
R7414:Ttc39b UTSW 4 83242222 missense probably damaging 0.99
X0064:Ttc39b UTSW 4 83260939 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGAAAAGTTATGCTTTCAAGGTTCCC -3'
(R):5'- CAGAGAAGTTCGCTGTGAGG -3'

Sequencing Primer
(F):5'- GTTATGCTTTCAAGGTTCCCTTTTAC -3'
(R):5'- AGTTCGCTGTGAGGAAGGC -3'
Posted On2019-10-17