Mutagenetix > Incidental Mutation

Incidental Mutation 'R7536:Skint6'

583582

Institutional Source

Beutler Lab

Gene Symbol

Skint6

Ensembl Gene

ENSMUSG00000087194

Gene Name

selection and upkeep of intraepithelial T cells 6

Synonyms

OTTMUSG00000008519

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R7536 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112804616-113286973 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 112811547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121870 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000138966] [ENSMUST00000171224] [ENSMUST00000171224]

AlphaFold

A7XUZ6

Predicted Effect

probably null
Transcript: ENSMUST00000138966

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000138966

SMART Domains

Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171224

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171224

SMART Domains

Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGv	44	125	2.32e-8	SMART
internal_repeat_1	219	594	1.11e-41	PROSPERO
low complexity region	601	610	N/A	INTRINSIC
low complexity region	678	690	N/A	INTRINSIC
internal_repeat_1	701	1076	1.11e-41	PROSPERO
transmembrane domain	1087	1104	N/A	INTRINSIC
transmembrane domain	1164	1186	N/A	INTRINSIC
transmembrane domain	1206	1228	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	C	T	13: 59,741,742	V755M	probably damaging	Het
3632451O06Rik	G	T	14: 49,774,246		probably null	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
AI597479	C	G	1: 43,111,345	A205G	possibly damaging	Het
Akr1c14	T	A	13: 4,063,690	V74E	probably damaging	Het
Bbs9	A	T	9: 22,670,800	Q596L	probably damaging	Het
Bub3	A	G	7: 131,568,703	D318G	probably damaging	Het
Cela1	A	G	15: 100,675,364	V248A	probably damaging	Het
Cer1	C	A	4: 82,884,968	R39L	probably benign	Het
Clec16a	A	G	16: 10,638,844	T624A	possibly damaging	Het
Coro1c	C	A	5: 113,845,289	G393W	probably damaging	Het
Crym	A	G	7: 120,201,108	L97P	probably damaging	Het
Cyp2a5	T	G	7: 26,840,478	L317R	probably damaging	Het
Cyp2j6	C	A	4: 96,535,537	G198V	probably damaging	Het
Dnajb6	A	G	5: 29,757,806	E238G	possibly damaging	Het
Dnhd1	C	A	7: 105,709,561	T3419K	probably damaging	Het
Dpep3	A	T	8: 105,977,400	I262K	probably damaging	Het
Dscam	T	G	16: 96,641,026		probably null	Het
Farsb	A	G	1: 78,443,754	V500A	possibly damaging	Het
Fbxl20	A	T	11: 98,095,383	C136*	probably null	Het
Fbxo43	G	T	15: 36,161,851	D403E	probably benign	Het
Frem1	A	G	4: 82,956,195	S1397P	probably damaging	Het
Fut8	A	G	12: 77,475,078	Y497C	probably damaging	Het
Gbp3	A	T	3: 142,566,395	R219S	probably damaging	Het
Gm14295	T	A	2: 176,810,929	H737Q	possibly damaging	Het
Gpr89	C	A	3: 96,890,893	R149L	probably damaging	Het
Greb1	A	T	12: 16,682,185	Y1592N	probably damaging	Het
Gria4	A	C	9: 4,464,298	Y555D	probably damaging	Het
Hspa1b	T	A	17: 34,958,875	T45S	possibly damaging	Het
Kif5b	A	T	18: 6,216,235	N571K	probably benign	Het
Mapkbp1	T	A	2: 120,018,585	M694K	probably damaging	Het
Med24	G	A	11: 98,712,621	H439Y	possibly damaging	Het
Mgl2	G	T	11: 70,137,007	R347L	probably benign	Het
Mms22l	T	A	4: 24,581,240	L850Q	probably damaging	Het
Mrpl51	T	C	6: 125,192,567	V44A	possibly damaging	Het
Mylk3	T	C	8: 85,353,604	I485V	probably benign	Het
Olfr1116	C	T	2: 87,269,599	Q273*	probably null	Het
Olfr868	C	A	9: 20,101,530	T257K	probably damaging	Het
Pde4dip	A	G	3: 97,757,244	L434P	probably damaging	Het
Pla2g4a	T	C	1: 149,880,017	Y223C	probably damaging	Het
Plcl1	C	T	1: 55,713,481	Q995*	probably null	Het
Pls1	C	T	9: 95,762,057	C462Y	probably damaging	Het
Ppp6r3	T	C	19: 3,507,341	E249G	possibly damaging	Het
Prb1	T	A	6: 132,207,221	N483I	unknown	Het
R3hdm1	A	G	1: 128,182,211		probably null	Het
Rasgrp3	T	C	17: 75,514,133	F445S	probably damaging	Het
Rnf39	G	T	17: 36,943,117	L10F	probably damaging	Het
Rnh1	T	C	7: 141,160,812	D410G	possibly damaging	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Sh3bp2	A	G	5: 34,543,557	T35A	probably benign	Het
Slc13a1	A	T	6: 24,100,331	D384E	probably damaging	Het
Slc27a6	A	G	18: 58,556,626	T55A	probably damaging	Het
Slc46a2	G	A	4: 59,914,141	Q261*	probably null	Het
St7	C	G	6: 17,886,020	P327R	probably damaging	Het
Stx1a	T	C	5: 135,049,840	I268T	probably damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmem144	A	T	3: 79,827,657	N151K	probably benign	Het
Tmem145	T	C	7: 25,307,869	S171P	probably damaging	Het
Traf2	A	G	2: 25,537,106	Y78H	possibly damaging	Het
Tsc22d1	A	G	14: 76,504,763	Y16C	probably benign	Het
Ttc39b	A	T	4: 83,239,978	Y503*	probably null	Het
Ttn	T	C	2: 76,717,337	D32163G	probably benign	Het
Uba6	A	T	5: 86,124,332	S833T	probably benign	Het
Wdtc1	A	G	4: 133,295,250	L595P	probably damaging	Het

Other mutations in Skint6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Skint6	APN	4	112804682	missense	possibly damaging	0.96
IGL01296:Skint6	APN	4	113236440	missense	probably benign	0.37
IGL01343:Skint6	APN	4	113283626	missense	probably benign	0.07
IGL01543:Skint6	APN	4	112899963	missense	probably benign	0.18
IGL01633:Skint6	APN	4	113238049	missense	probably damaging	1.00
IGL01818:Skint6	APN	4	112948569	missense	probably benign	0.18
IGL02124:Skint6	APN	4	113087796	missense	probably benign
IGL02517:Skint6	APN	4	112948540	splice site	probably benign
IGL02647:Skint6	APN	4	113127891	splice site	probably benign
IGL02887:Skint6	APN	4	113238184	nonsense	probably null
IGL03026:Skint6	APN	4	112991244	splice site	probably null
IGL03030:Skint6	APN	4	113012956	missense	probably benign	0.03
meissner	UTSW	4	112804694	missense	possibly damaging	0.86
Tegmentum	UTSW	4	112842822	splice site	probably null
PIT4576001:Skint6	UTSW	4	113053367	missense	possibly damaging	0.91
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0058:Skint6	UTSW	4	113046815	splice site	probably benign
R0099:Skint6	UTSW	4	112811501	missense	possibly damaging	0.53
R0158:Skint6	UTSW	4	113184814	splice site	probably benign
R0164:Skint6	UTSW	4	112991236	splice site	probably benign
R0312:Skint6	UTSW	4	112809100	missense	possibly damaging	0.86
R0591:Skint6	UTSW	4	112858169	splice site	probably benign
R0762:Skint6	UTSW	4	112865651	splice site	probably benign
R0941:Skint6	UTSW	4	113238358	missense	probably damaging	1.00
R1023:Skint6	UTSW	4	113238103	missense	probably benign	0.20
R1132:Skint6	UTSW	4	112898099	critical splice donor site	probably null
R1228:Skint6	UTSW	4	112854452	missense	probably benign
R1338:Skint6	UTSW	4	113012961	missense	possibly damaging	0.53
R1432:Skint6	UTSW	4	112869524	splice site	probably benign
R1512:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R1577:Skint6	UTSW	4	113148523	missense	possibly damaging	0.53
R1733:Skint6	UTSW	4	113177037	splice site	probably benign
R1762:Skint6	UTSW	4	113236481	missense	probably damaging	0.98
R1891:Skint6	UTSW	4	112846696	missense	possibly damaging	0.85
R1908:Skint6	UTSW	4	112891990	missense	probably benign
R2069:Skint6	UTSW	4	113238132	missense	probably damaging	1.00
R2089:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2091:Skint6	UTSW	4	112846684	missense	probably benign
R2144:Skint6	UTSW	4	113236260	missense	possibly damaging	0.84
R2166:Skint6	UTSW	4	112854452	missense	probably benign	0.01
R2192:Skint6	UTSW	4	112865712	nonsense	probably null
R2267:Skint6	UTSW	4	112842822	splice site	probably null
R2312:Skint6	UTSW	4	113238142	missense	probably damaging	1.00
R2324:Skint6	UTSW	4	112872457	splice site	probably null
R2342:Skint6	UTSW	4	113176983	missense	probably benign	0.00
R3028:Skint6	UTSW	4	113236493	missense	possibly damaging	0.92
R3704:Skint6	UTSW	4	113136472	missense	possibly damaging	0.86
R3752:Skint6	UTSW	4	112842899	splice site	probably benign
R3760:Skint6	UTSW	4	112937458	missense	possibly damaging	0.53
R3827:Skint6	UTSW	4	112937437	missense	probably benign
R4377:Skint6	UTSW	4	113236518	missense	possibly damaging	0.90
R4406:Skint6	UTSW	4	113156486	missense	probably benign	0.01
R4611:Skint6	UTSW	4	113074076	missense	probably benign
R4780:Skint6	UTSW	4	113236397	missense	probably damaging	0.98
R4788:Skint6	UTSW	4	113238336	missense	possibly damaging	0.54
R4818:Skint6	UTSW	4	112955392	intron	probably benign
R4900:Skint6	UTSW	4	113067470	missense	probably benign	0.03
R4972:Skint6	UTSW	4	112835068	missense	probably benign
R5008:Skint6	UTSW	4	112991255	missense	possibly damaging	0.86
R5016:Skint6	UTSW	4	113171533	critical splice acceptor site	probably null
R5085:Skint6	UTSW	4	113236268	missense	probably damaging	0.99
R5165:Skint6	UTSW	4	112865668	missense	possibly damaging	0.86
R5221:Skint6	UTSW	4	112894924	splice site	probably null
R5310:Skint6	UTSW	4	113184768	nonsense	probably null
R5423:Skint6	UTSW	4	112850740	missense	possibly damaging	0.93
R5436:Skint6	UTSW	4	113096591	missense	probably benign	0.08
R5447:Skint6	UTSW	4	113105909	missense	probably benign	0.34
R5564:Skint6	UTSW	4	112988965	missense	possibly damaging	0.72
R5629:Skint6	UTSW	4	113012979	missense	possibly damaging	0.86
R5936:Skint6	UTSW	4	113096593	missense	probably benign	0.33
R5993:Skint6	UTSW	4	112809079	missense	probably benign	0.02
R6027:Skint6	UTSW	4	113096564	splice site	probably null
R6174:Skint6	UTSW	4	112839313	missense	possibly damaging	0.53
R6497:Skint6	UTSW	4	113236398	missense	probably damaging	0.98
R6552:Skint6	UTSW	4	113067490	missense	possibly damaging	0.86
R6645:Skint6	UTSW	4	112892038	missense	possibly damaging	0.53
R6810:Skint6	UTSW	4	112948380	splice site	probably null
R7003:Skint6	UTSW	4	113105912	missense	probably benign	0.01
R7211:Skint6	UTSW	4	113238369	missense	probably benign	0.09
R7269:Skint6	UTSW	4	112854489	splice site	probably null
R7398:Skint6	UTSW	4	112898138	missense	probably benign	0.00
R7438:Skint6	UTSW	4	113238228	missense	probably damaging	1.00
R7461:Skint6	UTSW	4	113177046	splice site	probably null
R7613:Skint6	UTSW	4	113177046	splice site	probably null
R7956:Skint6	UTSW	4	112846697	missense	possibly damaging	0.85
R8118:Skint6	UTSW	4	112865675	missense	possibly damaging	0.53
R8118:Skint6	UTSW	4	113156494	missense	possibly damaging	0.73
R8197:Skint6	UTSW	4	112894843	splice site	probably null
R8218:Skint6	UTSW	4	112839274	splice site	probably null
R8344:Skint6	UTSW	4	113236445	missense	probably damaging	1.00
R8518:Skint6	UTSW	4	113238268	missense	possibly damaging	0.58
R8776:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8776-TAIL:Skint6	UTSW	4	112804688	missense	possibly damaging	0.96
R8794:Skint6	UTSW	4	113192672	missense	possibly damaging	0.73
R8796:Skint6	UTSW	4	112804694	missense	possibly damaging	0.86
R8812:Skint6	UTSW	4	112988952	missense	probably benign	0.00
R8866:Skint6	UTSW	4	112854453	missense	probably benign
R8881:Skint6	UTSW	4	112815519	missense	possibly damaging	0.53
R8949:Skint6	UTSW	4	113074099	missense	probably benign	0.04
R8967:Skint6	UTSW	4	112872504	nonsense	probably null
R9005:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9007:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9053:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9055:Skint6	UTSW	4	113238150	missense	probably damaging	1.00
R9144:Skint6	UTSW	4	113127905	missense	possibly damaging	0.73
R9149:Skint6	UTSW	4	113176976	missense	probably damaging	0.98
R9297:Skint6	UTSW	4	112811520	missense	probably benign	0.00
R9388:Skint6	UTSW	4	113192641	missense	possibly damaging	0.85
R9407:Skint6	UTSW	4	113177027	missense	possibly damaging	0.53
R9475:Skint6	UTSW	4	112806840	critical splice donor site	probably null
R9515:Skint6	UTSW	4	112858178	missense	probably benign
R9572:Skint6	UTSW	4	113127931	missense	probably benign
R9689:Skint6	UTSW	4	113236349	missense	probably damaging	0.99
R9744:Skint6	UTSW	4	112809163	missense	probably damaging	1.00
R9785:Skint6	UTSW	4	112883687	missense	possibly damaging	0.86
Z1176:Skint6	UTSW	4	112892014	missense	possibly damaging	0.53
Z1176:Skint6	UTSW	4	113238294	missense	probably damaging	0.96
Z1176:Skint6	UTSW	4	113238295	missense	possibly damaging	0.83
Z1177:Skint6	UTSW	4	112806928	missense	possibly damaging	0.96
Z1177:Skint6	UTSW	4	113105961	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGTGCCTTAGTCAGATGAAG -3'
(R):5'- CATGCTGTTTGAGGAGAATGAGTAG -3'

Sequencing Primer
(F):5'- GCCTTAGTCAGATGAAGCATATTTTC -3'
(R):5'- GATACCTCATAGTCATTCCAGGCATG -3'

Posted On

2019-10-17