Incidental Mutation 'R7536:Slc13a1'
ID583590
Institutional Source Beutler Lab
Gene Symbol Slc13a1
Ensembl Gene ENSMUSG00000029700
Gene Namesolute carrier family 13 (sodium/sulfate symporters), member 1
SynonymsNaSi-1, Nas1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7536 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location24088283-24168092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24100331 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 384 (D384E)
Ref Sequence ENSEMBL: ENSMUSP00000031713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031713]
Predicted Effect probably damaging
Transcript: ENSMUST00000031713
AA Change: D384E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031713
Gene: ENSMUSG00000029700
AA Change: D384E

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 5 578 9.6e-101 PFAM
Pfam:CitMHS 45 168 3.9e-14 PFAM
Pfam:CitMHS 226 521 3.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an apical membrane Na(+)-sulfate cotransporter involved in sulfate homeostasis in the kidney. Defects in this gene lead to many pathophysiologic problems. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit hyposulfatemia, growth retardation, reduced female fertility, and spontaneous clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,742 V755M probably damaging Het
3632451O06Rik G T 14: 49,774,246 probably null Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
AI597479 C G 1: 43,111,345 A205G possibly damaging Het
Akr1c14 T A 13: 4,063,690 V74E probably damaging Het
Bbs9 A T 9: 22,670,800 Q596L probably damaging Het
Bub3 A G 7: 131,568,703 D318G probably damaging Het
Cela1 A G 15: 100,675,364 V248A probably damaging Het
Cer1 C A 4: 82,884,968 R39L probably benign Het
Clec16a A G 16: 10,638,844 T624A possibly damaging Het
Coro1c C A 5: 113,845,289 G393W probably damaging Het
Crym A G 7: 120,201,108 L97P probably damaging Het
Cyp2a5 T G 7: 26,840,478 L317R probably damaging Het
Cyp2j6 C A 4: 96,535,537 G198V probably damaging Het
Dnajb6 A G 5: 29,757,806 E238G possibly damaging Het
Dnhd1 C A 7: 105,709,561 T3419K probably damaging Het
Dpep3 A T 8: 105,977,400 I262K probably damaging Het
Dscam T G 16: 96,641,026 probably null Het
Farsb A G 1: 78,443,754 V500A possibly damaging Het
Fbxl20 A T 11: 98,095,383 C136* probably null Het
Fbxo43 G T 15: 36,161,851 D403E probably benign Het
Frem1 A G 4: 82,956,195 S1397P probably damaging Het
Fut8 A G 12: 77,475,078 Y497C probably damaging Het
Gbp3 A T 3: 142,566,395 R219S probably damaging Het
Gm14295 T A 2: 176,810,929 H737Q possibly damaging Het
Gpr89 C A 3: 96,890,893 R149L probably damaging Het
Greb1 A T 12: 16,682,185 Y1592N probably damaging Het
Gria4 A C 9: 4,464,298 Y555D probably damaging Het
Hspa1b T A 17: 34,958,875 T45S possibly damaging Het
Kif5b A T 18: 6,216,235 N571K probably benign Het
Mapkbp1 T A 2: 120,018,585 M694K probably damaging Het
Med24 G A 11: 98,712,621 H439Y possibly damaging Het
Mgl2 G T 11: 70,137,007 R347L probably benign Het
Mms22l T A 4: 24,581,240 L850Q probably damaging Het
Mrpl51 T C 6: 125,192,567 V44A possibly damaging Het
Mylk3 T C 8: 85,353,604 I485V probably benign Het
Olfr1116 C T 2: 87,269,599 Q273* probably null Het
Olfr868 C A 9: 20,101,530 T257K probably damaging Het
Pde4dip A G 3: 97,757,244 L434P probably damaging Het
Pla2g4a T C 1: 149,880,017 Y223C probably damaging Het
Plcl1 C T 1: 55,713,481 Q995* probably null Het
Pls1 C T 9: 95,762,057 C462Y probably damaging Het
Ppp6r3 T C 19: 3,507,341 E249G possibly damaging Het
Prb1 T A 6: 132,207,221 N483I unknown Het
R3hdm1 A G 1: 128,182,211 probably null Het
Rasgrp3 T C 17: 75,514,133 F445S probably damaging Het
Rnf39 G T 17: 36,943,117 L10F probably damaging Het
Rnh1 T C 7: 141,160,812 D410G possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh3bp2 A G 5: 34,543,557 T35A probably benign Het
Skint6 T A 4: 112,811,547 probably null Het
Slc27a6 A G 18: 58,556,626 T55A probably damaging Het
Slc46a2 G A 4: 59,914,141 Q261* probably null Het
St7 C G 6: 17,886,020 P327R probably damaging Het
Stx1a T C 5: 135,049,840 I268T probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmem144 A T 3: 79,827,657 N151K probably benign Het
Tmem145 T C 7: 25,307,869 S171P probably damaging Het
Traf2 A G 2: 25,537,106 Y78H possibly damaging Het
Tsc22d1 A G 14: 76,504,763 Y16C probably benign Het
Ttc39b A T 4: 83,239,978 Y503* probably null Het
Ttn T C 2: 76,717,337 D32163G probably benign Het
Uba6 A T 5: 86,124,332 S833T probably benign Het
Wdtc1 A G 4: 133,295,250 L595P probably damaging Het
Other mutations in Slc13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc13a1 APN 6 24118017 missense possibly damaging 0.55
IGL01096:Slc13a1 APN 6 24104077 missense probably damaging 0.97
IGL01788:Slc13a1 APN 6 24134372 missense probably damaging 0.96
IGL02028:Slc13a1 APN 6 24118031 missense probably benign 0.00
IGL02238:Slc13a1 APN 6 24103483 missense probably benign 0.00
IGL02525:Slc13a1 APN 6 24137136 missense probably damaging 1.00
IGL02741:Slc13a1 APN 6 24150708 critical splice donor site probably null
IGL02894:Slc13a1 APN 6 24137042 splice site probably benign
IGL03086:Slc13a1 APN 6 24118003 missense probably damaging 1.00
munchkin UTSW 6 24090796 nonsense probably null
R0294:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R0419:Slc13a1 UTSW 6 24100293 missense probably damaging 0.99
R1249:Slc13a1 UTSW 6 24133650 missense probably benign 0.01
R1401:Slc13a1 UTSW 6 24118083 splice site probably null
R1868:Slc13a1 UTSW 6 24118000 missense probably damaging 1.00
R2191:Slc13a1 UTSW 6 24134397 missense possibly damaging 0.71
R2940:Slc13a1 UTSW 6 24090780 missense possibly damaging 0.79
R3740:Slc13a1 UTSW 6 24134477 missense probably damaging 1.00
R4326:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4327:Slc13a1 UTSW 6 24103479 missense probably benign 0.00
R4389:Slc13a1 UTSW 6 24092398 splice site probably null
R4520:Slc13a1 UTSW 6 24134513 missense probably benign 0.18
R4771:Slc13a1 UTSW 6 24100340 nonsense probably null
R4883:Slc13a1 UTSW 6 24134357 missense probably benign 0.01
R5133:Slc13a1 UTSW 6 24103429 missense possibly damaging 0.95
R5213:Slc13a1 UTSW 6 24108159 missense probably damaging 1.00
R5310:Slc13a1 UTSW 6 24134374 missense probably benign 0.02
R5504:Slc13a1 UTSW 6 24150744 missense possibly damaging 0.83
R5971:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
R6214:Slc13a1 UTSW 6 24090796 nonsense probably null
R6215:Slc13a1 UTSW 6 24090796 nonsense probably null
R6526:Slc13a1 UTSW 6 24097612 missense probably damaging 0.97
R6562:Slc13a1 UTSW 6 24150793 missense probably benign 0.35
R6573:Slc13a1 UTSW 6 24137095 missense probably damaging 1.00
R6902:Slc13a1 UTSW 6 24097666 missense possibly damaging 0.65
R7184:Slc13a1 UTSW 6 24092312 missense probably damaging 0.99
R7918:Slc13a1 UTSW 6 24118066 missense probably benign 0.35
U15987:Slc13a1 UTSW 6 24133657 missense probably benign 0.00
Z1177:Slc13a1 UTSW 6 24133695 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTAGGTGGAGGCAAACTC -3'
(R):5'- TGGTCTTTGCAAGTTACTTCAC -3'

Sequencing Primer
(F):5'- CTCCAGCTGAGTGAGGAAC -3'
(R):5'- TTGCAAGTTACTTCACTTTACTGG -3'
Posted On2019-10-17