Incidental Mutation 'R7536:Fbxl20'
ID583607
Institutional Source Beutler Lab
Gene Symbol Fbxl20
Ensembl Gene ENSMUSG00000020883
Gene NameF-box and leucine-rich repeat protein 20
Synonyms2610511F20Rik, C86145, 4632423N09Rik, Fbl2, Scrapper, Scr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R7536 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98082556-98150403 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 98095383 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 136 (C136*)
Ref Sequence ENSEMBL: ENSMUSP00000123507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103143] [ENSMUST00000147971] [ENSMUST00000150378]
Predicted Effect probably benign
Transcript: ENSMUST00000103143
SMART Domains Protein: ENSMUSP00000099432
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
FBOX 28 68 2.62e-8 SMART
LRR 90 115 2.02e-1 SMART
LRR 116 141 1.77e1 SMART
LRR 142 167 7.9e-4 SMART
LRR_CC 168 193 4.61e-5 SMART
LRR 194 219 7.15e-2 SMART
LRR 220 245 1.67e-2 SMART
LRR 246 271 1.2e-3 SMART
LRR 272 297 2.61e-4 SMART
LRR 298 323 1.26e-2 SMART
LRR_CC 324 349 1.77e-6 SMART
LRR 353 377 6.06e2 SMART
LRR 378 403 2.14e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000147971
AA Change: C136*
SMART Domains Protein: ENSMUSP00000123507
Gene: ENSMUSG00000020883
AA Change: C136*

DomainStartEndE-ValueType
LRR 14 39 7.15e-2 SMART
LRR 40 65 1.67e-2 SMART
LRR 66 91 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150378
SMART Domains Protein: ENSMUSP00000119003
Gene: ENSMUSG00000020883

DomainStartEndE-ValueType
FBOX 30 70 2.62e-8 SMART
LRR 92 117 3.69e1 SMART
LRR 121 146 7.9e-4 SMART
LRR_CC 147 172 4.61e-5 SMART
LRR 173 198 7.15e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL20, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, shortened lifespans, decreased body size and altered CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,742 V755M probably damaging Het
3632451O06Rik G T 14: 49,774,246 probably null Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
AI597479 C G 1: 43,111,345 A205G possibly damaging Het
Akr1c14 T A 13: 4,063,690 V74E probably damaging Het
Bbs9 A T 9: 22,670,800 Q596L probably damaging Het
Bub3 A G 7: 131,568,703 D318G probably damaging Het
Cela1 A G 15: 100,675,364 V248A probably damaging Het
Cer1 C A 4: 82,884,968 R39L probably benign Het
Clec16a A G 16: 10,638,844 T624A possibly damaging Het
Coro1c C A 5: 113,845,289 G393W probably damaging Het
Crym A G 7: 120,201,108 L97P probably damaging Het
Cyp2a5 T G 7: 26,840,478 L317R probably damaging Het
Cyp2j6 C A 4: 96,535,537 G198V probably damaging Het
Dnajb6 A G 5: 29,757,806 E238G possibly damaging Het
Dnhd1 C A 7: 105,709,561 T3419K probably damaging Het
Dpep3 A T 8: 105,977,400 I262K probably damaging Het
Dscam T G 16: 96,641,026 probably null Het
Farsb A G 1: 78,443,754 V500A possibly damaging Het
Fbxo43 G T 15: 36,161,851 D403E probably benign Het
Frem1 A G 4: 82,956,195 S1397P probably damaging Het
Fut8 A G 12: 77,475,078 Y497C probably damaging Het
Gbp3 A T 3: 142,566,395 R219S probably damaging Het
Gm14295 T A 2: 176,810,929 H737Q possibly damaging Het
Gpr89 C A 3: 96,890,893 R149L probably damaging Het
Greb1 A T 12: 16,682,185 Y1592N probably damaging Het
Gria4 A C 9: 4,464,298 Y555D probably damaging Het
Hspa1b T A 17: 34,958,875 T45S possibly damaging Het
Kif5b A T 18: 6,216,235 N571K probably benign Het
Mapkbp1 T A 2: 120,018,585 M694K probably damaging Het
Med24 G A 11: 98,712,621 H439Y possibly damaging Het
Mgl2 G T 11: 70,137,007 R347L probably benign Het
Mms22l T A 4: 24,581,240 L850Q probably damaging Het
Mrpl51 T C 6: 125,192,567 V44A possibly damaging Het
Mylk3 T C 8: 85,353,604 I485V probably benign Het
Olfr1116 C T 2: 87,269,599 Q273* probably null Het
Olfr868 C A 9: 20,101,530 T257K probably damaging Het
Pde4dip A G 3: 97,757,244 L434P probably damaging Het
Pla2g4a T C 1: 149,880,017 Y223C probably damaging Het
Plcl1 C T 1: 55,713,481 Q995* probably null Het
Pls1 C T 9: 95,762,057 C462Y probably damaging Het
Ppp6r3 T C 19: 3,507,341 E249G possibly damaging Het
Prb1 T A 6: 132,207,221 N483I unknown Het
R3hdm1 A G 1: 128,182,211 probably null Het
Rasgrp3 T C 17: 75,514,133 F445S probably damaging Het
Rnf39 G T 17: 36,943,117 L10F probably damaging Het
Rnh1 T C 7: 141,160,812 D410G possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh3bp2 A G 5: 34,543,557 T35A probably benign Het
Skint6 T A 4: 112,811,547 probably null Het
Slc13a1 A T 6: 24,100,331 D384E probably damaging Het
Slc27a6 A G 18: 58,556,626 T55A probably damaging Het
Slc46a2 G A 4: 59,914,141 Q261* probably null Het
St7 C G 6: 17,886,020 P327R probably damaging Het
Stx1a T C 5: 135,049,840 I268T probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmem144 A T 3: 79,827,657 N151K probably benign Het
Tmem145 T C 7: 25,307,869 S171P probably damaging Het
Traf2 A G 2: 25,537,106 Y78H possibly damaging Het
Tsc22d1 A G 14: 76,504,763 Y16C probably benign Het
Ttc39b A T 4: 83,239,978 Y503* probably null Het
Ttn T C 2: 76,717,337 D32163G probably benign Het
Uba6 A T 5: 86,124,332 S833T probably benign Het
Wdtc1 A G 4: 133,295,250 L595P probably damaging Het
Other mutations in Fbxl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00161:Fbxl20 APN 11 98090674 missense possibly damaging 0.70
IGL00590:Fbxl20 APN 11 98093129 missense probably damaging 1.00
IGL00944:Fbxl20 APN 11 98113242 missense probably damaging 1.00
IGL00966:Fbxl20 APN 11 98110974 missense probably damaging 1.00
IGL01344:Fbxl20 APN 11 98100100 nonsense probably null
IGL02394:Fbxl20 APN 11 98113256 missense probably damaging 1.00
R0270:Fbxl20 UTSW 11 98098503 splice site probably benign
R1564:Fbxl20 UTSW 11 98098486 missense probably damaging 1.00
R2227:Fbxl20 UTSW 11 98090849 missense probably benign 0.12
R3902:Fbxl20 UTSW 11 98097035 missense probably benign 0.03
R4158:Fbxl20 UTSW 11 98095394 unclassified probably benign
R4516:Fbxl20 UTSW 11 98095235 unclassified probably benign
R4916:Fbxl20 UTSW 11 98128360 missense probably damaging 1.00
R5905:Fbxl20 UTSW 11 98115445 missense probably damaging 1.00
R6791:Fbxl20 UTSW 11 98109510 missense probably benign 0.05
R6916:Fbxl20 UTSW 11 98113253 missense possibly damaging 0.78
R7381:Fbxl20 UTSW 11 98090788 missense probably benign 0.01
X0067:Fbxl20 UTSW 11 98096978 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TTAACTGGGAACATCTGGCCAC -3'
(R):5'- TGCGACCTGTGTGAAAGACAG -3'

Sequencing Primer
(F):5'- GGAACATCTGGCCACTTCTAATATTC -3'
(R):5'- ACAGAAAATAGTTACTTCAGCAACAG -3'
Posted On2019-10-17