Incidental Mutation 'R7536:1700014D04Rik'
ID 583612
Institutional Source Beutler Lab
Gene Symbol 1700014D04Rik
Ensembl Gene ENSMUSG00000051054
Gene Name RIKEN cDNA 1700014D04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock # R7536 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 59740842-59746752 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59741742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 755 (V755M)
Ref Sequence ENSEMBL: ENSMUSP00000136424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055343] [ENSMUST00000178508] [ENSMUST00000180139]
AlphaFold J3QMS2
Predicted Effect probably benign
Transcript: ENSMUST00000055343
SMART Domains Protein: ENSMUSP00000052403
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 253 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178508
SMART Domains Protein: ENSMUSP00000136897
Gene: ENSMUSG00000051054

DomainStartEndE-ValueType
Pfam:FAM75 66 99 7.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180139
AA Change: V755M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136424
Gene: ENSMUSG00000051054
AA Change: V755M

DomainStartEndE-ValueType
Pfam:FAM75 66 439 6.9e-97 PFAM
low complexity region 622 633 N/A INTRINSIC
low complexity region 671 693 N/A INTRINSIC
low complexity region 737 763 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,774,246 probably null Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
AI597479 C G 1: 43,111,345 A205G possibly damaging Het
Akr1c14 T A 13: 4,063,690 V74E probably damaging Het
Bbs9 A T 9: 22,670,800 Q596L probably damaging Het
Bub3 A G 7: 131,568,703 D318G probably damaging Het
Cela1 A G 15: 100,675,364 V248A probably damaging Het
Cer1 C A 4: 82,884,968 R39L probably benign Het
Clec16a A G 16: 10,638,844 T624A possibly damaging Het
Coro1c C A 5: 113,845,289 G393W probably damaging Het
Crym A G 7: 120,201,108 L97P probably damaging Het
Cyp2a5 T G 7: 26,840,478 L317R probably damaging Het
Cyp2j6 C A 4: 96,535,537 G198V probably damaging Het
Dnajb6 A G 5: 29,757,806 E238G possibly damaging Het
Dnhd1 C A 7: 105,709,561 T3419K probably damaging Het
Dpep3 A T 8: 105,977,400 I262K probably damaging Het
Dscam T G 16: 96,641,026 probably null Het
Farsb A G 1: 78,443,754 V500A possibly damaging Het
Fbxl20 A T 11: 98,095,383 C136* probably null Het
Fbxo43 G T 15: 36,161,851 D403E probably benign Het
Frem1 A G 4: 82,956,195 S1397P probably damaging Het
Fut8 A G 12: 77,475,078 Y497C probably damaging Het
Gbp3 A T 3: 142,566,395 R219S probably damaging Het
Gm14295 T A 2: 176,810,929 H737Q possibly damaging Het
Gpr89 C A 3: 96,890,893 R149L probably damaging Het
Greb1 A T 12: 16,682,185 Y1592N probably damaging Het
Gria4 A C 9: 4,464,298 Y555D probably damaging Het
Hspa1b T A 17: 34,958,875 T45S possibly damaging Het
Kif5b A T 18: 6,216,235 N571K probably benign Het
Mapkbp1 T A 2: 120,018,585 M694K probably damaging Het
Med24 G A 11: 98,712,621 H439Y possibly damaging Het
Mgl2 G T 11: 70,137,007 R347L probably benign Het
Mms22l T A 4: 24,581,240 L850Q probably damaging Het
Mrpl51 T C 6: 125,192,567 V44A possibly damaging Het
Mylk3 T C 8: 85,353,604 I485V probably benign Het
Olfr1116 C T 2: 87,269,599 Q273* probably null Het
Olfr868 C A 9: 20,101,530 T257K probably damaging Het
Pde4dip A G 3: 97,757,244 L434P probably damaging Het
Pla2g4a T C 1: 149,880,017 Y223C probably damaging Het
Plcl1 C T 1: 55,713,481 Q995* probably null Het
Pls1 C T 9: 95,762,057 C462Y probably damaging Het
Ppp6r3 T C 19: 3,507,341 E249G possibly damaging Het
Prb1 T A 6: 132,207,221 N483I unknown Het
R3hdm1 A G 1: 128,182,211 probably null Het
Rasgrp3 T C 17: 75,514,133 F445S probably damaging Het
Rnf39 G T 17: 36,943,117 L10F probably damaging Het
Rnh1 T C 7: 141,160,812 D410G possibly damaging Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh3bp2 A G 5: 34,543,557 T35A probably benign Het
Skint6 T A 4: 112,811,547 probably null Het
Slc13a1 A T 6: 24,100,331 D384E probably damaging Het
Slc27a6 A G 18: 58,556,626 T55A probably damaging Het
Slc46a2 G A 4: 59,914,141 Q261* probably null Het
St7 C G 6: 17,886,020 P327R probably damaging Het
Stx1a T C 5: 135,049,840 I268T probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmem144 A T 3: 79,827,657 N151K probably benign Het
Tmem145 T C 7: 25,307,869 S171P probably damaging Het
Traf2 A G 2: 25,537,106 Y78H possibly damaging Het
Tsc22d1 A G 14: 76,504,763 Y16C probably benign Het
Ttc39b A T 4: 83,239,978 Y503* probably null Het
Ttn T C 2: 76,717,337 D32163G probably benign Het
Uba6 A T 5: 86,124,332 S833T probably benign Het
Wdtc1 A G 4: 133,295,250 L595P probably damaging Het
Other mutations in 1700014D04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB010:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
BB020:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R0838:1700014D04Rik UTSW 13 59742468 missense possibly damaging 0.75
R1483:1700014D04Rik UTSW 13 59742903 missense probably damaging 0.99
R1794:1700014D04Rik UTSW 13 59742620 missense probably benign 0.22
R1842:1700014D04Rik UTSW 13 59742506 missense probably damaging 1.00
R1969:1700014D04Rik UTSW 13 59742785 missense probably damaging 0.98
R2027:1700014D04Rik UTSW 13 59742587 missense possibly damaging 0.48
R2206:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2207:1700014D04Rik UTSW 13 59743106 missense probably benign 0.40
R2882:1700014D04Rik UTSW 13 59742943 missense probably benign 0.00
R3508:1700014D04Rik UTSW 13 59742505 nonsense probably null
R4447:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R4560:1700014D04Rik UTSW 13 59741757 missense probably damaging 1.00
R4846:1700014D04Rik UTSW 13 59742233 missense probably benign 0.00
R5186:1700014D04Rik UTSW 13 59743739 missense probably damaging 1.00
R5510:1700014D04Rik UTSW 13 59742420 splice site probably null
R5580:1700014D04Rik UTSW 13 59742256 missense probably benign 0.00
R5752:1700014D04Rik UTSW 13 59743202 missense probably damaging 0.96
R6266:1700014D04Rik UTSW 13 59742312 missense probably benign 0.33
R6267:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6296:1700014D04Rik UTSW 13 59742683 missense probably benign 0.13
R6939:1700014D04Rik UTSW 13 59742058 missense possibly damaging 0.75
R6973:1700014D04Rik UTSW 13 59742707 missense probably benign 0.14
R7107:1700014D04Rik UTSW 13 59742183 nonsense probably null
R7123:1700014D04Rik UTSW 13 59743440 nonsense probably null
R7254:1700014D04Rik UTSW 13 59741976 missense probably benign 0.01
R7354:1700014D04Rik UTSW 13 59741834 nonsense probably null
R7729:1700014D04Rik UTSW 13 59741623 missense not run
R7912:1700014D04Rik UTSW 13 59742515 missense probably damaging 1.00
R7933:1700014D04Rik UTSW 13 59743751 missense probably damaging 1.00
R8029:1700014D04Rik UTSW 13 59742377 missense possibly damaging 0.79
R8347:1700014D04Rik UTSW 13 59742236 missense possibly damaging 0.63
R8370:1700014D04Rik UTSW 13 59743952 missense probably benign
R8395:1700014D04Rik UTSW 13 59741726 missense probably benign 0.00
R8508:1700014D04Rik UTSW 13 59743598 missense probably benign 0.02
R8930:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R8932:1700014D04Rik UTSW 13 59742201 missense possibly damaging 0.76
R9127:1700014D04Rik UTSW 13 59743014 missense probably benign 0.00
R9262:1700014D04Rik UTSW 13 59742588 missense probably benign 0.00
R9401:1700014D04Rik UTSW 13 59742198 missense probably benign 0.03
R9514:1700014D04Rik UTSW 13 59742992 missense probably damaging 0.96
X0024:1700014D04Rik UTSW 13 59742725 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGTTCCCTCTTGCTTG -3'
(R):5'- GGCAGAGCCCATCAAAGATG -3'

Sequencing Primer
(F):5'- AATTCCTGAGGGTCGCTTC -3'
(R):5'- AGATGTCAGTCCCTGAAGAGCC -3'
Posted On 2019-10-17