Mutagenetix > Incidental Mutation

Incidental Mutation 'R7537:Astn1'

583628

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R7537 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

158362273-158691781 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158505386 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 346 (E346G)

Ref Sequence

ENSEMBL: ENSMUSP00000142322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000194369] [ENSMUST00000195311]

AlphaFold

Q61137

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046110
AA Change: E346G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: E346G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170718
AA Change: E346G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: E346G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
Blast:MACPF	811	835	3e-7	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193042
AA Change: E346G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: E346G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194369
AA Change: E346G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: E346G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
Blast:MACPF	803	828	2e-7	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195311
AA Change: E346G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: E346G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Meta Mutation Damage Score

0.0747

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,173,988	L2229P	possibly damaging	Het
Acaca	T	A	11: 84,260,634	M786K	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adap1	T	G	5: 139,293,173	E117D	possibly damaging	Het
Ap5z1	T	C	5: 142,477,298	S746P	probably benign	Het
Appl2	A	G	10: 83,617,428	I208T	possibly damaging	Het
Atp23	T	A	10: 126,868,725	I180L	unknown	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Cdh23	A	T	10: 60,384,945	I1340N	probably benign	Het
Cdh8	G	A	8: 99,098,885	Q493*	probably null	Het
Ces1g	T	C	8: 93,319,827	I357V	probably benign	Het
Ddx46	A	G	13: 55,650,478	D226G	probably damaging	Het
Eea1	C	T	10: 95,994,905	Q143*	probably null	Het
Erlin2	G	T	8: 27,031,772		probably null	Het
Fat3	T	A	9: 15,938,319	D3929V	probably damaging	Het
Flt3	T	C	5: 147,334,437	D898G	probably damaging	Het
Gm16519	A	G	17: 70,929,356	N100S	probably benign	Het
Gnl1	A	G	17: 35,988,536	H533R	probably damaging	Het
Gphn	A	G	12: 78,504,680	T301A	possibly damaging	Het
Herc2	C	T	7: 56,219,779	R4295*	probably null	Het
Insm2	T	C	12: 55,599,518	S16P	possibly damaging	Het
Jak2	C	T	19: 29,298,637	T778I	probably benign	Het
Lrriq3	A	G	3: 155,101,097	T128A	probably damaging	Het
Lst1	A	G	17: 35,186,944		probably null	Het
Magi1	G	T	6: 93,708,110	Y762*	probably null	Het
Man2b1	T	A	8: 85,090,965	C358*	probably null	Het
Mga	T	C	2: 119,935,551	V1432A	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Morc2a	C	T	11: 3,683,566	Q587*	probably null	Het
Mrc2	T	C	11: 105,292,797	I4T	probably benign	Het
Muc16	C	A	9: 18,638,135	V5621F	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myo3b	A	G	2: 70,217,169	R340G	probably benign	Het
Nipal3	T	C	4: 135,490,937	Y34C	probably damaging	Het
Nktr	T	A	9: 121,749,279	D804E	unknown	Het
Nlrp4b	A	G	7: 10,714,889	M340V	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr385	T	A	11: 73,589,268	T157S	probably benign	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr701	G	A	7: 106,818,374	C97Y	probably damaging	Het
Pard3	T	A	8: 127,610,582	N1271K	probably damaging	Het
Pcdhb11	A	T	18: 37,421,619	M1L	possibly damaging	Het
Pclo	T	C	5: 14,682,104	V3540A	unknown	Het
Pemt	A	G	11: 59,976,844	F154S	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rnpc3	G	T	3: 113,613,832	T376K	probably benign	Het
Rpe65	A	G	3: 159,604,609	Y143C	probably damaging	Het
Sbk2	T	C	7: 4,963,149	E12G	probably benign	Het
Slc2a5	T	C	4: 150,129,069	I106T	possibly damaging	Het
Snx13	A	G	12: 35,085,982	D92G	probably damaging	Het
Sorl1	C	T	9: 41,980,688	V1889I	probably benign	Het
Spag17	A	T	3: 99,939,247	N29I	possibly damaging	Het
Speg	T	C	1: 75,401,464	V878A	probably damaging	Het
Timp4	A	G	6: 115,250,460	S53P	probably damaging	Het
Tssk1	G	T	16: 17,895,084	E244D	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Vmn2r85	A	T	10: 130,422,866	V440E	probably benign	Het
Wdr59	T	C	8: 111,490,369	D270G		Het
Zbbx	G	A	3: 75,085,519	P223S	probably damaging	Het
Zfp936	T	A	7: 43,189,815	C235*	probably null	Het
Zranb3	A	T	1: 128,032,847		probably null	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158600319	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158504313	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158580327	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158668631	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158511154	intron	probably benign
IGL02168:Astn1	APN	1	158609341	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158664130	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158510950	splice site	probably benign
IGL02307:Astn1	APN	1	158674614	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158502408	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158505395	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158688550	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158612395	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158668623	splice site	probably benign
IGL03354:Astn1	APN	1	158688604	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158597209	missense	probably benign	0.20
PIT4366001:Astn1	UTSW	1	158597211	missense	probably benign	0.23
R0024:Astn1	UTSW	1	158684215	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158579724	splice site	probably benign
R0099:Astn1	UTSW	1	158502151	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158664104	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158688548	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158509891	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158600389	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158472389	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158509890	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158511109	nonsense	probably null
R1027:Astn1	UTSW	1	158580279	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158600365	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158502353	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158579576	splice site	probably benign
R1701:Astn1	UTSW	1	158504307	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158504251	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158601945	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158505316	splice site	probably null
R1919:Astn1	UTSW	1	158509971	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158520521	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158609305	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158657120	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158600502	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158472408	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158667609	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158502150	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158657306	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158502099	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158579666	missense	probably damaging	0.99
R2428:Astn1	UTSW	1	158612346	missense	possibly damaging	0.66
R2980:Astn1	UTSW	1	158572951	critical splice acceptor site	probably null
R3713:Astn1	UTSW	1	158667532	missense	possibly damaging	0.83
R3745:Astn1	UTSW	1	158502060	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158579657	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158502032	splice site	probably null
R4625:Astn1	UTSW	1	158580294	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158502251	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158657193	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158612532	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158580363	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158600380	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158601937	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158509993	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158664121	nonsense	probably null
R6481:Astn1	UTSW	1	158612462	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158511148	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158664122	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158612472	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158664074	nonsense	probably null
R7062:Astn1	UTSW	1	158688511	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158572987	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158664276	splice site	probably null
R7402:Astn1	UTSW	1	158552855	intron	probably benign
R7412:Astn1	UTSW	1	158502349	missense	probably damaging	0.98
R7487:Astn1	UTSW	1	158610782	splice site	probably null
R7537:Astn1	UTSW	1	158667638	splice site	probably null
R7635:Astn1	UTSW	1	158667535	nonsense	probably null
R7890:Astn1	UTSW	1	158580333	missense	probably damaging	1.00
R7894:Astn1	UTSW	1	158601938	missense	probably damaging	0.98
R7904:Astn1	UTSW	1	158597316	missense	probably benign	0.37
R8048:Astn1	UTSW	1	158688638	missense	probably benign	0.00
R8061:Astn1	UTSW	1	158504350	critical splice donor site	probably null
R8096:Astn1	UTSW	1	158609320	missense	probably damaging	1.00
R8327:Astn1	UTSW	1	158609280	missense	probably damaging	1.00
R8374:Astn1	UTSW	1	158502233	missense	probably damaging	1.00
R8400:Astn1	UTSW	1	158657100	missense	probably benign	0.09
R8983:Astn1	UTSW	1	158664130	critical splice donor site	probably null
R9013:Astn1	UTSW	1	158520500	missense	probably damaging	1.00
R9110:Astn1	UTSW	1	158668757	missense	probably benign	0.01
R9156:Astn1	UTSW	1	158510985	missense	probably damaging	0.99
R9355:Astn1	UTSW	1	158684151	missense	probably damaging	1.00
R9683:Astn1	UTSW	1	158664049	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158472497	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158597206	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158684096	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAGAGCACTATCTGTTGCTC -3'
(R):5'- TGAAGTTGGCTCCAGTCCAC -3'

Sequencing Primer
(F):5'- TCTTCACAAGCCTGGGTATCAAG -3'
(R):5'- TTGGCTCCAGTCCACAGAGTG -3'

Posted On

2019-10-17