Incidental Mutation 'R7537:Olfr1039'
ID583630
Institutional Source Beutler Lab
Gene Symbol Olfr1039
Ensembl Gene ENSMUSG00000075204
Gene Nameolfactory receptor 1039
SynonymsMOR185-5, MOR185-5, GA_x6K02T2Q125-47600809-47599850, MOR185-9P, Olfr1517, MOR185-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86127995-86135928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86131264 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 133 (V133A)
Ref Sequence ENSEMBL: ENSMUSP00000150584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099910] [ENSMUST00000214364] [ENSMUST00000216566] [ENSMUST00000216665]
Predicted Effect probably benign
Transcript: ENSMUST00000099910
AA Change: V133A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097494
Gene: ENSMUSG00000075204
AA Change: V133A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1e-50 PFAM
Pfam:7tm_1 41 290 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214364
AA Change: V133A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216566
AA Change: V133A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216665
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Olfr1039
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Olfr1039 APN 2 86131668 utr 5 prime probably benign
IGL01981:Olfr1039 APN 2 86130830 missense probably benign 0.44
IGL02958:Olfr1039 APN 2 86131007 missense probably benign 0.00
R0645:Olfr1039 UTSW 2 86131034 missense probably damaging 1.00
R1052:Olfr1039 UTSW 2 86131571 missense probably benign 0.13
R1613:Olfr1039 UTSW 2 86131063 missense probably damaging 1.00
R2132:Olfr1039 UTSW 2 86131261 missense possibly damaging 0.52
R3956:Olfr1039 UTSW 2 86131019 missense probably benign
R6372:Olfr1039 UTSW 2 86130854 missense possibly damaging 0.50
R7338:Olfr1039 UTSW 2 86131382 missense probably damaging 0.99
R7514:Olfr1039 UTSW 2 86131628 missense probably damaging 1.00
R7535:Olfr1039 UTSW 2 86131264 missense probably benign 0.00
R8052:Olfr1039 UTSW 2 86131377 nonsense probably null
RF005:Olfr1039 UTSW 2 86131070 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGTGTCAGAACAGGCCAG -3'
(R):5'- GCTAATCCAAGTCAGCCCTC -3'

Sequencing Primer
(F):5'- CAGAGCAACTAAGGGGACATCATC -3'
(R):5'- CACTTGGCATTCGTTGATTTCTG -3'
Posted On2019-10-17