Mutagenetix > Incidental Mutation

Incidental Mutation 'R7537:Mga'

583631

Institutional Source

Beutler Lab

Gene Symbol

Mga

Ensembl Gene

ENSMUSG00000033943

Gene Name

MAX gene associated

Synonyms

D030062C11Rik, Mga, Mad5, C130042M01Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Essential gene?

Probably essential (E-score: 0.930) question?

Stock #

R7537 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119897228-119969581 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119935551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1432 (V1432A)

Ref Sequence

ENSEMBL: ENSMUSP00000119044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046717
AA Change: V1433A

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: V1433A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	6e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1796	1818	N/A	INTRINSIC
low complexity region	1833	1850	N/A	INTRINSIC
low complexity region	1977	1992	N/A	INTRINSIC
low complexity region	2183	2197	N/A	INTRINSIC
low complexity region	2241	2259	N/A	INTRINSIC
HLH	2368	2419	8.27e-7	SMART
low complexity region	2748	2769	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000079934
AA Change: V1432A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: V1432A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART
low complexity region	2578	2599	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110773
AA Change: V1354A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: V1354A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	890	899	N/A	INTRINSIC
low complexity region	938	952	N/A	INTRINSIC
low complexity region	1033	1059	N/A	INTRINSIC
low complexity region	1169	1190	N/A	INTRINSIC
low complexity region	1222	1236	N/A	INTRINSIC
low complexity region	1485	1502	N/A	INTRINSIC
low complexity region	1555	1570	N/A	INTRINSIC
low complexity region	1602	1637	N/A	INTRINSIC
low complexity region	1717	1739	N/A	INTRINSIC
low complexity region	1754	1771	N/A	INTRINSIC
low complexity region	1898	1913	N/A	INTRINSIC
low complexity region	2104	2118	N/A	INTRINSIC
low complexity region	2162	2180	N/A	INTRINSIC
HLH	2289	2340	8.27e-7	SMART
low complexity region	2669	2690	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110774
AA Change: V1433A

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: V1433A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	7e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
Pfam:DUF4801	1037	1085	1e-19	PFAM
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1835	1857	N/A	INTRINSIC
low complexity region	1872	1889	N/A	INTRINSIC
low complexity region	2016	2031	N/A	INTRINSIC
low complexity region	2222	2236	N/A	INTRINSIC
low complexity region	2280	2298	N/A	INTRINSIC
HLH	2407	2458	8.27e-7	SMART
low complexity region	2787	2808	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156510
AA Change: V1432A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: V1432A

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	4e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]

Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,173,988	L2229P	possibly damaging	Het
Acaca	T	A	11: 84,260,634	M786K	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adap1	T	G	5: 139,293,173	E117D	possibly damaging	Het
Ap5z1	T	C	5: 142,477,298	S746P	probably benign	Het
Appl2	A	G	10: 83,617,428	I208T	possibly damaging	Het
Astn1	G	A	1: 158,667,638		probably null	Het
Astn1	A	G	1: 158,505,386	E346G	possibly damaging	Het
Atp23	T	A	10: 126,868,725	I180L	unknown	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Cdh23	A	T	10: 60,384,945	I1340N	probably benign	Het
Cdh8	G	A	8: 99,098,885	Q493*	probably null	Het
Ces1g	T	C	8: 93,319,827	I357V	probably benign	Het
Ddx46	A	G	13: 55,650,478	D226G	probably damaging	Het
Eea1	C	T	10: 95,994,905	Q143*	probably null	Het
Erlin2	G	T	8: 27,031,772		probably null	Het
Fat3	T	A	9: 15,938,319	D3929V	probably damaging	Het
Flt3	T	C	5: 147,334,437	D898G	probably damaging	Het
Gm16519	A	G	17: 70,929,356	N100S	probably benign	Het
Gnl1	A	G	17: 35,988,536	H533R	probably damaging	Het
Gphn	A	G	12: 78,504,680	T301A	possibly damaging	Het
Herc2	C	T	7: 56,219,779	R4295*	probably null	Het
Insm2	T	C	12: 55,599,518	S16P	possibly damaging	Het
Jak2	C	T	19: 29,298,637	T778I	probably benign	Het
Lrriq3	A	G	3: 155,101,097	T128A	probably damaging	Het
Lst1	A	G	17: 35,186,944		probably null	Het
Magi1	G	T	6: 93,708,110	Y762*	probably null	Het
Man2b1	T	A	8: 85,090,965	C358*	probably null	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Morc2a	C	T	11: 3,683,566	Q587*	probably null	Het
Mrc2	T	C	11: 105,292,797	I4T	probably benign	Het
Muc16	C	A	9: 18,638,135	V5621F	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myo3b	A	G	2: 70,217,169	R340G	probably benign	Het
Nipal3	T	C	4: 135,490,937	Y34C	probably damaging	Het
Nktr	T	A	9: 121,749,279	D804E	unknown	Het
Nlrp4b	A	G	7: 10,714,889	M340V	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr385	T	A	11: 73,589,268	T157S	probably benign	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr701	G	A	7: 106,818,374	C97Y	probably damaging	Het
Pard3	T	A	8: 127,610,582	N1271K	probably damaging	Het
Pcdhb11	A	T	18: 37,421,619	M1L	possibly damaging	Het
Pclo	T	C	5: 14,682,104	V3540A	unknown	Het
Pemt	A	G	11: 59,976,844	F154S	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rnpc3	G	T	3: 113,613,832	T376K	probably benign	Het
Rpe65	A	G	3: 159,604,609	Y143C	probably damaging	Het
Sbk2	T	C	7: 4,963,149	E12G	probably benign	Het
Slc2a5	T	C	4: 150,129,069	I106T	possibly damaging	Het
Snx13	A	G	12: 35,085,982	D92G	probably damaging	Het
Sorl1	C	T	9: 41,980,688	V1889I	probably benign	Het
Spag17	A	T	3: 99,939,247	N29I	possibly damaging	Het
Speg	T	C	1: 75,401,464	V878A	probably damaging	Het
Timp4	A	G	6: 115,250,460	S53P	probably damaging	Het
Tssk1	G	T	16: 17,895,084	E244D	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Vmn2r85	A	T	10: 130,422,866	V440E	probably benign	Het
Wdr59	T	C	8: 111,490,369	D270G		Het
Zbbx	G	A	3: 75,085,519	P223S	probably damaging	Het
Zfp936	T	A	7: 43,189,815	C235*	probably null	Het
Zranb3	A	T	1: 128,032,847		probably null	Het

Other mutations in Mga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Mga	APN	2	119919814	missense	possibly damaging	0.65
IGL00719:Mga	APN	2	119947453	nonsense	probably null
IGL01619:Mga	APN	2	119931828	missense	possibly damaging	0.46
IGL01721:Mga	APN	2	119935239	missense	probably damaging	1.00
IGL01759:Mga	APN	2	119951195	missense	possibly damaging	0.92
IGL01785:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01786:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01950:Mga	APN	2	119941654	missense	possibly damaging	0.60
IGL01960:Mga	APN	2	119938657	missense	probably damaging	1.00
IGL02086:Mga	APN	2	119924036	missense	probably damaging	0.99
IGL02364:Mga	APN	2	119964054	missense	possibly damaging	0.66
IGL02602:Mga	APN	2	119931884	missense	possibly damaging	0.66
IGL02751:Mga	APN	2	119947770	missense	possibly damaging	0.82
IGL02794:Mga	APN	2	119946289	missense	possibly damaging	0.84
IGL03247:Mga	APN	2	119935513	missense	possibly damaging	0.81
IGL03303:Mga	APN	2	119903452	missense	probably damaging	1.00
PIT4515001:Mga	UTSW	2	119916504	missense	probably damaging	1.00
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0417:Mga	UTSW	2	119902790	missense	probably damaging	0.99
R0449:Mga	UTSW	2	119941381	missense	probably damaging	1.00
R0457:Mga	UTSW	2	119916488	missense	probably damaging	0.98
R0538:Mga	UTSW	2	119919706	critical splice donor site	probably null
R0568:Mga	UTSW	2	119935422	missense	probably damaging	1.00
R0614:Mga	UTSW	2	119964466	missense	probably damaging	1.00
R0671:Mga	UTSW	2	119919910	splice site	probably null
R0811:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0812:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0948:Mga	UTSW	2	119941659	missense	possibly damaging	0.77
R1177:Mga	UTSW	2	119926446	missense	probably damaging	1.00
R1445:Mga	UTSW	2	119902698	missense	probably damaging	1.00
R1476:Mga	UTSW	2	119941675	missense	probably damaging	0.96
R1527:Mga	UTSW	2	119916597	missense	probably damaging	1.00
R1583:Mga	UTSW	2	119963960	missense	possibly damaging	0.66
R1592:Mga	UTSW	2	119964666	missense	possibly damaging	0.93
R1627:Mga	UTSW	2	119964562	missense	probably damaging	1.00
R1658:Mga	UTSW	2	119941689	missense	possibly damaging	0.63
R1677:Mga	UTSW	2	119960852	missense	possibly damaging	0.92
R1887:Mga	UTSW	2	119923617	missense	probably damaging	1.00
R1908:Mga	UTSW	2	119926594	missense	possibly damaging	0.66
R1909:Mga	UTSW	2	119926594	missense	possibly damaging	0.66
R2061:Mga	UTSW	2	119964980	unclassified	probably benign
R2145:Mga	UTSW	2	119964157	missense	possibly damaging	0.85
R2159:Mga	UTSW	2	119919643	missense	probably damaging	0.96
R2179:Mga	UTSW	2	119960442	missense	probably damaging	0.99
R2281:Mga	UTSW	2	119903723	missense	probably benign
R2423:Mga	UTSW	2	119964793	missense	probably damaging	1.00
R3620:Mga	UTSW	2	119916668	missense	probably damaging	1.00
R3622:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3624:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3802:Mga	UTSW	2	119947339	missense	probably damaging	0.96
R4011:Mga	UTSW	2	119931780	missense	probably damaging	1.00
R4065:Mga	UTSW	2	119947002	missense	probably damaging	1.00
R4520:Mga	UTSW	2	119948098	missense	possibly damaging	0.85
R4649:Mga	UTSW	2	119941493	missense	possibly damaging	0.81
R4660:Mga	UTSW	2	119938623	intron	probably benign
R4757:Mga	UTSW	2	119903639	missense	possibly damaging	0.82
R4771:Mga	UTSW	2	119964294	missense	probably damaging	1.00
R4784:Mga	UTSW	2	119903057	missense	probably damaging	1.00
R4866:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4900:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4952:Mga	UTSW	2	119903301	missense	probably damaging	1.00
R4995:Mga	UTSW	2	119932582	nonsense	probably null
R5020:Mga	UTSW	2	119951173	nonsense	probably null
R5082:Mga	UTSW	2	119903344	missense	probably damaging	0.98
R5208:Mga	UTSW	2	119947981	missense	possibly damaging	0.83
R5454:Mga	UTSW	2	119903329	missense	probably damaging	0.99
R5466:Mga	UTSW	2	119902697	missense	probably damaging	1.00
R5484:Mga	UTSW	2	119916626	missense	possibly damaging	0.58
R5669:Mga	UTSW	2	119903426	missense	probably damaging	1.00
R5819:Mga	UTSW	2	119941263	missense	possibly damaging	0.61
R5916:Mga	UTSW	2	119964312	missense	probably benign	0.27
R5942:Mga	UTSW	2	119946959	missense	probably benign	0.41
R6305:Mga	UTSW	2	119947698	missense	probably benign	0.00
R6434:Mga	UTSW	2	119923938	missense	probably damaging	0.99
R6467:Mga	UTSW	2	119946295	missense	probably damaging	1.00
R6488:Mga	UTSW	2	119960907	missense	probably damaging	1.00
R6630:Mga	UTSW	2	119923659	missense	probably damaging	0.99
R6790:Mga	UTSW	2	119923754	missense	probably damaging	0.99
R7029:Mga	UTSW	2	119923550	missense	probably damaging	1.00
R7039:Mga	UTSW	2	119932678	missense	probably benign	0.28
R7088:Mga	UTSW	2	119961936	missense	probably damaging	1.00
R7195:Mga	UTSW	2	119917328	missense	probably damaging	1.00
R7273:Mga	UTSW	2	119935214	missense	probably damaging	1.00
R7286:Mga	UTSW	2	119964788	missense	possibly damaging	0.93
R7346:Mga	UTSW	2	119935527	missense	possibly damaging	0.56
R7383:Mga	UTSW	2	119960340	missense	probably damaging	0.99
R7469:Mga	UTSW	2	119903046	missense	probably damaging	1.00
R7484:Mga	UTSW	2	119946229	missense	probably damaging	0.99
R7781:Mga	UTSW	2	119917357	missense	probably damaging	1.00
R7921:Mga	UTSW	2	119919678	missense	probably damaging	1.00
R8165:Mga	UTSW	2	119947238	missense	probably benign	0.12
R8226:Mga	UTSW	2	119960385	missense	probably benign	0.33
R8305:Mga	UTSW	2	119946319	missense	possibly damaging	0.77
R8309:Mga	UTSW	2	119960930	missense	probably damaging	1.00
R8363:Mga	UTSW	2	119963926	missense	probably benign	0.43
R8388:Mga	UTSW	2	119964081	missense	probably benign	0.00
R8524:Mga	UTSW	2	119941516	missense	probably damaging	0.97
R8693:Mga	UTSW	2	119963926	missense	possibly damaging	0.65
R8837:Mga	UTSW	2	119938791	splice site	probably benign
R8916:Mga	UTSW	2	119958338	missense	possibly damaging	0.92
R8936:Mga	UTSW	2	119964228	missense	probably damaging	1.00
R9028:Mga	UTSW	2	119947589	missense	probably benign
R9145:Mga	UTSW	2	119964012	missense	probably benign
R9155:Mga	UTSW	2	119926532	missense	probably damaging	1.00
R9308:Mga	UTSW	2	119923888	missense	possibly damaging	0.91
R9342:Mga	UTSW	2	119948175	missense	probably benign
R9347:Mga	UTSW	2	119903037	missense	probably damaging	1.00
R9390:Mga	UTSW	2	119963851	missense	probably damaging	0.99
R9408:Mga	UTSW	2	119935518	missense	possibly damaging	0.92
R9488:Mga	UTSW	2	119964823	missense	possibly damaging	0.90
R9495:Mga	UTSW	2	119951195	missense	possibly damaging	0.92
R9521:Mga	UTSW	2	119964498	missense	probably damaging	0.99
R9780:Mga	UTSW	2	119916772	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- ATCATTGAGTTGGCTTCTCAGC -3'
(R):5'- CTAAGGTCAACAAAGGGGCTTG -3'

Sequencing Primer
(F):5'- GCTTCTCAGCGGAAGTGTC -3'
(R):5'- CCCAGATGTAGTTGAACTGG -3'

Posted On

2019-10-17