Incidental Mutation 'R7537:Rnpc3'
ID583634
Institutional Source Beutler Lab
Gene Symbol Rnpc3
Ensembl Gene ENSMUSG00000027981
Gene NameRNA-binding region (RNP1, RRM) containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location113605067-113630149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113613832 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 376 (T376K)
Ref Sequence ENSEMBL: ENSMUSP00000089792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092154] [ENSMUST00000106535] [ENSMUST00000106536]
Predicted Effect probably benign
Transcript: ENSMUST00000092154
AA Change: T376K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000089792
Gene: ENSMUSG00000027981
AA Change: T376K

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106535
AA Change: T376K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102145
Gene: ENSMUSG00000027981
AA Change: T376K

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 4.1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106536
AA Change: T376K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102146
Gene: ENSMUSG00000027981
AA Change: T376K

DomainStartEndE-ValueType
RRM 28 98 2.28e-9 SMART
low complexity region 218 253 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
RRM 419 497 1.35e-11 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000115492
Gene: ENSMUSG00000027981
AA Change: T324K

DomainStartEndE-ValueType
Blast:RRM 2 47 8e-22 BLAST
SCOP:d1urna_ 3 53 4e-4 SMART
low complexity region 167 202 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
RRM 368 446 1.35e-11 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 65K protein that is a component of the U12-type spliceosome. This protein contains two RNA recognition motifs (RRMs), suggesting that it may contact one of the small nuclear RNAs of the minor spliceosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Rnpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02365:Rnpc3 APN 3 113608399 missense probably damaging 1.00
IGL02750:Rnpc3 APN 3 113621939 missense possibly damaging 0.81
R0316:Rnpc3 UTSW 3 113629973 missense probably damaging 1.00
R0420:Rnpc3 UTSW 3 113621869 missense probably benign 0.00
R0601:Rnpc3 UTSW 3 113620106 missense probably benign 0.18
R1051:Rnpc3 UTSW 3 113629946 missense possibly damaging 0.94
R1386:Rnpc3 UTSW 3 113613784 nonsense probably null
R1865:Rnpc3 UTSW 3 113621910 nonsense probably null
R1870:Rnpc3 UTSW 3 113611055 unclassified probably benign
R2045:Rnpc3 UTSW 3 113608360 missense possibly damaging 0.90
R4447:Rnpc3 UTSW 3 113611137 unclassified probably benign
R4450:Rnpc3 UTSW 3 113611137 unclassified probably benign
R4934:Rnpc3 UTSW 3 113624979 missense possibly damaging 0.86
R5436:Rnpc3 UTSW 3 113624999 missense probably damaging 1.00
R5474:Rnpc3 UTSW 3 113615509 nonsense probably null
R5498:Rnpc3 UTSW 3 113611207 critical splice donor site probably null
R5505:Rnpc3 UTSW 3 113615453 missense probably damaging 0.98
R5868:Rnpc3 UTSW 3 113616711 splice site probably null
R6123:Rnpc3 UTSW 3 113609056 splice site probably null
R7220:Rnpc3 UTSW 3 113628355 missense probably benign 0.01
R7240:Rnpc3 UTSW 3 113616831 missense probably damaging 1.00
R7507:Rnpc3 UTSW 3 113616761 missense probably benign
R7818:Rnpc3 UTSW 3 113629951 missense probably damaging 1.00
R7872:Rnpc3 UTSW 3 113622447 nonsense probably null
RF023:Rnpc3 UTSW 3 113620074 missense probably damaging 0.98
X0012:Rnpc3 UTSW 3 113629909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGACTGTGATGCATGG -3'
(R):5'- TGGTACTTTAGTAAATAGGACAGGG -3'

Sequencing Primer
(F):5'- GCTTCCCCAGTATAAGATATGAGG -3'
(R):5'- GGACAGGGAAAGAAATCTAAAATACG -3'
Posted On2019-10-17