Incidental Mutation 'R7537:Lrriq3'
ID583636
Institutional Source Beutler Lab
Gene Symbol Lrriq3
Ensembl Gene ENSMUSG00000028182
Gene Nameleucine-rich repeats and IQ motif containing 3
Synonyms4930511J15Rik, 4930438B07Rik, 4933403H06Rik, Lrrc44
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location155093434-155194280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155101097 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 128 (T128A)
Ref Sequence ENSEMBL: ENSMUSP00000029833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029833] [ENSMUST00000192383] [ENSMUST00000194376]
Predicted Effect probably damaging
Transcript: ENSMUST00000029833
AA Change: T128A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029833
Gene: ENSMUSG00000028182
AA Change: T128A

DomainStartEndE-ValueType
SCOP:d1dcea3 36 155 3e-14 SMART
Blast:LRR 71 94 3e-6 BLAST
Blast:LRR 96 118 1e-5 BLAST
IQ 214 236 3.68e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192383
AA Change: T128A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141372
Gene: ENSMUSG00000028182
AA Change: T128A

DomainStartEndE-ValueType
Pfam:LRR_8 50 109 9e-9 PFAM
Pfam:LRR_4 72 117 1.9e-8 PFAM
Pfam:LRR_1 73 94 5.1e-3 PFAM
IQ 214 236 3.68e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194376
AA Change: T128A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142127
Gene: ENSMUSG00000028182
AA Change: T128A

DomainStartEndE-ValueType
Pfam:LRR_8 50 109 7.2e-9 PFAM
Pfam:LRR_4 72 117 1.5e-8 PFAM
Pfam:LRR_1 73 94 4.2e-3 PFAM
IQ 214 236 3.68e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Lrriq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrriq3 APN 3 155101061 missense probably benign 0.29
IGL00468:Lrriq3 APN 3 155101179 missense probably damaging 1.00
IGL03272:Lrriq3 APN 3 155101058 missense probably damaging 0.99
PIT1430001:Lrriq3 UTSW 3 155098870 missense probably benign 0.36
R0526:Lrriq3 UTSW 3 155188297 missense probably benign 0.00
R0600:Lrriq3 UTSW 3 155187736 missense possibly damaging 0.51
R1420:Lrriq3 UTSW 3 155187712 missense probably benign
R2313:Lrriq3 UTSW 3 155164023 missense probably benign 0.00
R4024:Lrriq3 UTSW 3 155188302 missense probably benign 0.43
R4659:Lrriq3 UTSW 3 155129453 missense possibly damaging 0.47
R4801:Lrriq3 UTSW 3 155187970 missense probably benign
R4802:Lrriq3 UTSW 3 155187970 missense probably benign
R4864:Lrriq3 UTSW 3 155187810 missense possibly damaging 0.91
R4998:Lrriq3 UTSW 3 155188058 missense probably benign 0.13
R5120:Lrriq3 UTSW 3 155129384 missense probably benign 0.14
R5319:Lrriq3 UTSW 3 155129471 missense possibly damaging 0.88
R5406:Lrriq3 UTSW 3 155129501 critical splice donor site probably null
R5943:Lrriq3 UTSW 3 155163950 missense probably damaging 0.99
R6184:Lrriq3 UTSW 3 155129402 missense probably benign 0.09
R6572:Lrriq3 UTSW 3 155181675 missense probably benign 0.01
R7389:Lrriq3 UTSW 3 155188104 missense probably benign 0.00
R7636:Lrriq3 UTSW 3 155188150 missense probably damaging 1.00
R7806:Lrriq3 UTSW 3 155098807 missense probably damaging 0.99
R8038:Lrriq3 UTSW 3 155164001 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTTTTGGTTACTTACTAGGCACAC -3'
(R):5'- AAGCACCGTTGAGTGGGTTAC -3'

Sequencing Primer
(F):5'- GGCACACATAATTTACAAAACACTGG -3'
(R):5'- CCTTTATCAATGCTGGGTAAAGG -3'
Posted On2019-10-17