Incidental Mutation 'R7537:Rpe65'
ID583637
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Nameretinal pigment epithelium 65
SynonymsA930029L06Rik, Mord1, rd12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location159599175-159625321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 159604609 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 143 (Y143C)
Ref Sequence ENSEMBL: ENSMUSP00000029824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999] [ENSMUST00000197771]
Predicted Effect probably damaging
Transcript: ENSMUST00000029824
AA Change: Y143C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: Y143C

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196999
AA Change: Y143C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: Y143C

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197771
SMART Domains Protein: ENSMUSP00000143390
Gene: ENSMUSG00000028174

DomainStartEndE-ValueType
Pfam:RPE65 13 109 5.8e-19 PFAM
Meta Mutation Damage Score 0.7552 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159614542 missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159600405 splice site probably benign
IGL01815:Rpe65 APN 3 159604530 splice site probably null
IGL02085:Rpe65 APN 3 159615646 missense probably benign 0.00
IGL02232:Rpe65 APN 3 159604351 missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159624705 missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159606491 missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159622877 missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159600361 missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159604341 missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159614517 missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159615577 missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159624723 missense probably benign 0.35
R0571:Rpe65 UTSW 3 159600349 missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159601583 missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159606485 missense probably benign 0.07
R1597:Rpe65 UTSW 3 159614784 missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159614448 missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159622848 missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159615670 missense probably benign
R2259:Rpe65 UTSW 3 159615571 missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159604563 missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159604400 missense probably benign 0.16
R3975:Rpe65 UTSW 3 159604585 missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159604410 missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159624681 missense probably benign
R4924:Rpe65 UTSW 3 159622631 missense probably benign 0.01
R5269:Rpe65 UTSW 3 159604347 missense probably benign 0.07
R5324:Rpe65 UTSW 3 159604404 missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159604401 missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159615676 missense probably benign
R5907:Rpe65 UTSW 3 159615682 critical splice donor site probably null
R6149:Rpe65 UTSW 3 159614143 missense probably benign
R6660:Rpe65 UTSW 3 159614708 missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159614168 missense probably benign 0.06
R7025:Rpe65 UTSW 3 159622685 missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159615591 missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159622854 missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159624729 missense probably benign 0.13
R7679:Rpe65 UTSW 3 159604393 missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159614705 missense probably benign
R8179:Rpe65 UTSW 3 159624699 missense probably benign 0.06
R8409:Rpe65 UTSW 3 159614148 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCATAACAGAATTTGGCACCTG -3'
(R):5'- TTGGGGACTAGCAAGGAGTC -3'

Sequencing Primer
(F):5'- CCCCTGCAAGAATATATTTTCCAGG -3'
(R):5'- TGCTTGAGTAATGTCCCC -3'
Posted On2019-10-17