Incidental Mutation 'R7537:Ap5z1'
ID583643
Institutional Source Beutler Lab
Gene Symbol Ap5z1
Ensembl Gene ENSMUSG00000039623
Gene Nameadaptor-related protein complex 5, zeta 1 subunit
SynonymsC330006K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location142463944-142478710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142477298 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 746 (S746P)
Ref Sequence ENSEMBL: ENSMUSP00000041863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038699] [ENSMUST00000196055]
Predicted Effect probably benign
Transcript: ENSMUST00000038699
AA Change: S746P

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041863
Gene: ENSMUSG00000039623
AA Change: S746P

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 319 437 2.9e-45 PFAM
low complexity region 579 584 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196055
AA Change: S730P

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143179
Gene: ENSMUSG00000039623
AA Change: S730P

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 318 758 2.6e-181 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Ap5z1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Ap5z1 APN 5 142472251 missense probably benign 0.02
IGL01456:Ap5z1 APN 5 142468036 missense probably damaging 0.96
IGL01656:Ap5z1 APN 5 142470314 missense probably benign 0.10
IGL02079:Ap5z1 APN 5 142477113 critical splice donor site probably null
IGL02134:Ap5z1 APN 5 142474459 missense probably benign 0.09
IGL02662:Ap5z1 APN 5 142476889 splice site probably null
IGL02805:Ap5z1 APN 5 142470283 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0094:Ap5z1 UTSW 5 142476812 missense probably benign 0.00
R0395:Ap5z1 UTSW 5 142470562 unclassified probably benign
R0811:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R0812:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R1241:Ap5z1 UTSW 5 142470114 missense probably damaging 1.00
R1248:Ap5z1 UTSW 5 142474500 missense probably benign 0.02
R1374:Ap5z1 UTSW 5 142470458 missense probably damaging 1.00
R1616:Ap5z1 UTSW 5 142472236 missense probably benign 0.10
R1923:Ap5z1 UTSW 5 142472341 missense probably benign 0.30
R2423:Ap5z1 UTSW 5 142476777 missense probably benign 0.02
R3790:Ap5z1 UTSW 5 142470413 missense probably benign
R4859:Ap5z1 UTSW 5 142473993 missense possibly damaging 0.75
R4965:Ap5z1 UTSW 5 142467676 missense probably damaging 1.00
R5147:Ap5z1 UTSW 5 142466510 missense probably benign 0.02
R5311:Ap5z1 UTSW 5 142467687 missense possibly damaging 0.79
R5531:Ap5z1 UTSW 5 142467781 missense probably benign
R5569:Ap5z1 UTSW 5 142474451 missense probably damaging 0.99
R5725:Ap5z1 UTSW 5 142468976 missense probably damaging 1.00
R7287:Ap5z1 UTSW 5 142474047 missense probably damaging 0.99
R7407:Ap5z1 UTSW 5 142466575 missense probably benign 0.06
R7894:Ap5z1 UTSW 5 142466284 missense probably benign 0.34
R7894:Ap5z1 UTSW 5 142470436 nonsense probably null
R7895:Ap5z1 UTSW 5 142470558 critical splice donor site probably null
R8022:Ap5z1 UTSW 5 142470149 critical splice donor site probably null
R8244:Ap5z1 UTSW 5 142473980 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- ATCCCAAGGTACCCAGCTAG -3'
(R):5'- TTCAGGTGGTGACTGTCCCTTC -3'

Sequencing Primer
(F):5'- CTAGGAAGCACAGAGAAACCCATAG -3'
(R):5'- GGTGACTGTCCCTTCAACCTGG -3'
Posted On2019-10-17