Incidental Mutation 'R7537:Magi1'
ID 583645
Institutional Source Beutler Lab
Gene Symbol Magi1
Ensembl Gene ENSMUSG00000045095
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms Baiap1, Gukmi1, AIP3, BAP1, WWP3
MMRRC Submission 045609-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.561) question?
Stock # R7537 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 93652436-94260898 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 93685091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 762 (Y762*)
Ref Sequence ENSEMBL: ENSMUSP00000086730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055224] [ENSMUST00000089317] [ENSMUST00000093769] [ENSMUST00000203519] [ENSMUST00000203688] [ENSMUST00000204347] [ENSMUST00000204532]
AlphaFold Q6RHR9
PDB Structure X-ray crystal structure of MAGI-1 PDZ1 bound to the C-terminal peptide of HPV18 E6 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000055224
AA Change: Y749*
SMART Domains Protein: ENSMUSP00000062085
Gene: ENSMUSG00000045095
AA Change: Y749*

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 348 380 2.88e-9 SMART
low complexity region 390 402 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
PDZ 460 536 3.71e-18 SMART
PDZ 631 703 4.68e-15 SMART
low complexity region 707 714 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
PDZ 800 876 4.64e-19 SMART
low complexity region 920 942 N/A INTRINSIC
PDB:1UEW|A 945 977 2e-6 PDB
PDZ 1043 1117 1.26e-20 SMART
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000089317
AA Change: Y762*
SMART Domains Protein: ENSMUSP00000086730
Gene: ENSMUSG00000045095
AA Change: Y762*

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1074 6.1e-25 SMART
PDZ 1140 1214 6.1e-23 SMART
low complexity region 1347 1357 N/A INTRINSIC
low complexity region 1366 1423 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093769
AA Change: Y534*
SMART Domains Protein: ENSMUSP00000091283
Gene: ENSMUSG00000045095
AA Change: Y534*

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 492 499 N/A INTRINSIC
low complexity region 505 518 N/A INTRINSIC
PDZ 613 689 4.64e-19 SMART
low complexity region 733 755 N/A INTRINSIC
PDZ 771 858 2.3e-23 SMART
PDZ 924 998 1.26e-20 SMART
low complexity region 1131 1141 N/A INTRINSIC
low complexity region 1150 1207 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203519
AA Change: Y761*
SMART Domains Protein: ENSMUSP00000145244
Gene: ENSMUSG00000045095
AA Change: Y761*

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 360 392 2.88e-9 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 3.71e-18 SMART
PDZ 643 715 4.68e-15 SMART
low complexity region 719 726 N/A INTRINSIC
low complexity region 732 745 N/A INTRINSIC
PDZ 812 888 4.64e-19 SMART
low complexity region 932 954 N/A INTRINSIC
PDB:1UEW|A 957 989 2e-6 PDB
PDZ 1055 1115 1.13e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203688
AA Change: Y535*
SMART Domains Protein: ENSMUSP00000145515
Gene: ENSMUSG00000045095
AA Change: Y535*

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 2.9e-17 PFAM
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 506 519 N/A INTRINSIC
PDZ 614 690 4.64e-19 SMART
low complexity region 734 756 N/A INTRINSIC
PDZ 772 858 1.74e-23 SMART
PDZ 924 998 1.26e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204347
AA Change: Y762*
SMART Domains Protein: ENSMUSP00000144881
Gene: ENSMUSG00000045095
AA Change: Y762*

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1086 1.1e-25 SMART
PDZ 1152 1226 6.1e-23 SMART
low complexity region 1261 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204532
SMART Domains Protein: ENSMUSP00000144769
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 1.8e-14 PFAM
WW 74 106 5.8e-13 SMART
WW 133 165 1.7e-11 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 1.9e-20 SMART
PDZ 416 488 7.3e-17 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(165) : Targeted(2) Gene trapped(163)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 121,967,637 (GRCm39) L2229P possibly damaging Het
Acaca T A 11: 84,151,460 (GRCm39) M786K probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adap1 T G 5: 139,278,928 (GRCm39) E117D possibly damaging Het
Ap5z1 T C 5: 142,463,053 (GRCm39) S746P probably benign Het
Appl2 A G 10: 83,453,292 (GRCm39) I208T possibly damaging Het
Astn1 A G 1: 158,332,956 (GRCm39) E346G possibly damaging Het
Astn1 G A 1: 158,495,208 (GRCm39) probably null Het
Atp23 T A 10: 126,704,594 (GRCm39) I180L unknown Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cdh23 A T 10: 60,220,724 (GRCm39) I1340N probably benign Het
Cdh8 G A 8: 99,825,517 (GRCm39) Q493* probably null Het
Ces1g T C 8: 94,046,455 (GRCm39) I357V probably benign Het
Ddx46 A G 13: 55,798,291 (GRCm39) D226G probably damaging Het
Eea1 C T 10: 95,830,767 (GRCm39) Q143* probably null Het
Erlin2 G T 8: 27,521,800 (GRCm39) probably null Het
Fat3 T A 9: 15,849,615 (GRCm39) D3929V probably damaging Het
Flt3 T C 5: 147,271,247 (GRCm39) D898G probably damaging Het
Gm16519 A G 17: 71,236,351 (GRCm39) N100S probably benign Het
Gnl1 A G 17: 36,299,428 (GRCm39) H533R probably damaging Het
Gphn A G 12: 78,551,454 (GRCm39) T301A possibly damaging Het
Herc2 C T 7: 55,869,527 (GRCm39) R4295* probably null Het
Insm2 T C 12: 55,646,303 (GRCm39) S16P possibly damaging Het
Jak2 C T 19: 29,276,037 (GRCm39) T778I probably benign Het
Lrriq3 A G 3: 154,806,734 (GRCm39) T128A probably damaging Het
Lst1 A G 17: 35,405,920 (GRCm39) probably null Het
Man2b1 T A 8: 85,817,594 (GRCm39) C358* probably null Het
Mga T C 2: 119,766,032 (GRCm39) V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Morc2a C T 11: 3,633,566 (GRCm39) Q587* probably null Het
Mrc2 T C 11: 105,183,623 (GRCm39) I4T probably benign Het
Muc16 C A 9: 18,549,431 (GRCm39) V5621F probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myo3b A G 2: 70,047,513 (GRCm39) R340G probably benign Het
Nipal3 T C 4: 135,218,248 (GRCm39) Y34C probably damaging Het
Nktr T A 9: 121,578,345 (GRCm39) D804E unknown Het
Nlrp4b A G 7: 10,448,816 (GRCm39) M340V probably benign Het
Or1e26 T A 11: 73,480,094 (GRCm39) T157S probably benign Het
Or2ag2b G A 7: 106,417,581 (GRCm39) C97Y probably damaging Het
Or56a41 A T 7: 104,741,978 (GRCm39) M16K probably benign Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Pard3 T A 8: 128,337,063 (GRCm39) N1271K probably damaging Het
Pcdhb11 A T 18: 37,554,672 (GRCm39) M1L possibly damaging Het
Pclo T C 5: 14,732,118 (GRCm39) V3540A unknown Het
Pemt A G 11: 59,867,670 (GRCm39) F154S probably damaging Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rnpc3 G T 3: 113,407,481 (GRCm39) T376K probably benign Het
Rpe65 A G 3: 159,310,246 (GRCm39) Y143C probably damaging Het
Sbk2 T C 7: 4,966,148 (GRCm39) E12G probably benign Het
Slc2a5 T C 4: 150,213,526 (GRCm39) I106T possibly damaging Het
Snx13 A G 12: 35,135,981 (GRCm39) D92G probably damaging Het
Sorl1 C T 9: 41,891,984 (GRCm39) V1889I probably benign Het
Spag17 A T 3: 99,846,563 (GRCm39) N29I possibly damaging Het
Speg T C 1: 75,378,108 (GRCm39) V878A probably damaging Het
Timp4 A G 6: 115,227,421 (GRCm39) S53P probably damaging Het
Tssk1 G T 16: 17,712,948 (GRCm39) E244D probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Vmn2r85 A T 10: 130,258,735 (GRCm39) V440E probably benign Het
Wdr59 T C 8: 112,217,001 (GRCm39) D270G Het
Zbbx G A 3: 74,992,826 (GRCm39) P223S probably damaging Het
Zfp936 T A 7: 42,839,239 (GRCm39) C235* probably null Het
Zranb3 A T 1: 127,960,584 (GRCm39) probably null Het
Other mutations in Magi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Magi1 APN 6 94,260,074 (GRCm39) missense possibly damaging 0.86
IGL01457:Magi1 APN 6 93,724,205 (GRCm39) missense probably damaging 0.99
IGL01642:Magi1 APN 6 93,663,605 (GRCm39) missense possibly damaging 0.69
IGL01724:Magi1 APN 6 93,769,381 (GRCm39) splice site probably null
IGL01967:Magi1 APN 6 93,685,115 (GRCm39) missense probably damaging 1.00
IGL01984:Magi1 APN 6 93,685,155 (GRCm39) missense probably damaging 1.00
IGL02074:Magi1 APN 6 93,722,579 (GRCm39) missense probably damaging 1.00
IGL02098:Magi1 APN 6 93,655,768 (GRCm39) missense probably damaging 1.00
IGL02225:Magi1 APN 6 93,671,007 (GRCm39) missense probably damaging 1.00
IGL02522:Magi1 APN 6 93,655,617 (GRCm39) missense possibly damaging 0.89
IGL02659:Magi1 APN 6 93,762,591 (GRCm39) missense possibly damaging 0.68
IGL02900:Magi1 APN 6 93,663,854 (GRCm39) missense probably damaging 1.00
P0007:Magi1 UTSW 6 93,722,969 (GRCm39) missense probably damaging 1.00
R0149:Magi1 UTSW 6 93,724,226 (GRCm39) missense probably damaging 1.00
R0512:Magi1 UTSW 6 93,671,045 (GRCm39) missense probably damaging 1.00
R1487:Magi1 UTSW 6 93,685,060 (GRCm39) missense probably benign 0.00
R1497:Magi1 UTSW 6 93,724,310 (GRCm39) missense probably damaging 1.00
R1502:Magi1 UTSW 6 93,671,151 (GRCm39) missense probably damaging 1.00
R1824:Magi1 UTSW 6 93,676,620 (GRCm39) missense possibly damaging 0.94
R2042:Magi1 UTSW 6 93,732,026 (GRCm39) missense probably benign
R2132:Magi1 UTSW 6 93,674,255 (GRCm39) missense probably damaging 0.99
R2331:Magi1 UTSW 6 93,662,543 (GRCm39) missense probably damaging 1.00
R2418:Magi1 UTSW 6 93,722,891 (GRCm39) missense probably damaging 1.00
R3076:Magi1 UTSW 6 93,734,668 (GRCm39) missense possibly damaging 0.63
R3551:Magi1 UTSW 6 93,676,610 (GRCm39) missense probably damaging 0.98
R4005:Magi1 UTSW 6 93,678,299 (GRCm39) missense probably damaging 1.00
R4455:Magi1 UTSW 6 93,762,438 (GRCm39) missense probably damaging 1.00
R4670:Magi1 UTSW 6 93,663,624 (GRCm39) splice site probably null
R4671:Magi1 UTSW 6 93,657,768 (GRCm39) critical splice donor site probably null
R4839:Magi1 UTSW 6 93,671,177 (GRCm39) missense probably damaging 1.00
R5132:Magi1 UTSW 6 93,660,072 (GRCm39) critical splice acceptor site probably null
R5147:Magi1 UTSW 6 93,724,248 (GRCm39) missense probably damaging 1.00
R5525:Magi1 UTSW 6 93,769,354 (GRCm39) missense possibly damaging 0.95
R5724:Magi1 UTSW 6 93,722,682 (GRCm39) missense probably damaging 1.00
R5724:Magi1 UTSW 6 93,657,852 (GRCm39) missense probably benign 0.03
R5846:Magi1 UTSW 6 93,662,584 (GRCm39) missense probably damaging 1.00
R5896:Magi1 UTSW 6 93,685,180 (GRCm39) missense probably damaging 1.00
R5912:Magi1 UTSW 6 93,685,126 (GRCm39) missense possibly damaging 0.95
R6112:Magi1 UTSW 6 93,722,571 (GRCm39) missense probably damaging 1.00
R6115:Magi1 UTSW 6 93,685,051 (GRCm39) missense possibly damaging 0.64
R6351:Magi1 UTSW 6 93,920,210 (GRCm39) missense possibly damaging 0.82
R6355:Magi1 UTSW 6 94,260,177 (GRCm39) missense probably benign 0.06
R6457:Magi1 UTSW 6 93,676,620 (GRCm39) missense probably damaging 1.00
R6464:Magi1 UTSW 6 93,676,770 (GRCm39) missense probably damaging 1.00
R6613:Magi1 UTSW 6 93,722,654 (GRCm39) missense probably damaging 1.00
R6661:Magi1 UTSW 6 93,920,289 (GRCm39) missense probably benign 0.08
R6755:Magi1 UTSW 6 93,685,158 (GRCm39) missense probably damaging 1.00
R6909:Magi1 UTSW 6 93,674,301 (GRCm39) missense probably damaging 1.00
R7180:Magi1 UTSW 6 93,792,731 (GRCm39) missense probably benign 0.10
R7224:Magi1 UTSW 6 93,660,070 (GRCm39) missense probably benign 0.34
R7447:Magi1 UTSW 6 93,722,562 (GRCm39) missense possibly damaging 0.63
R7517:Magi1 UTSW 6 93,685,189 (GRCm39) missense probably damaging 0.99
R7549:Magi1 UTSW 6 93,685,095 (GRCm39) missense probably benign 0.19
R7566:Magi1 UTSW 6 93,655,308 (GRCm39) missense probably benign 0.03
R7805:Magi1 UTSW 6 93,659,927 (GRCm39) missense probably benign
R8022:Magi1 UTSW 6 93,674,346 (GRCm39) missense probably damaging 1.00
R8290:Magi1 UTSW 6 94,260,066 (GRCm39) missense probably damaging 1.00
R8519:Magi1 UTSW 6 93,681,330 (GRCm39) missense possibly damaging 0.83
R8762:Magi1 UTSW 6 93,792,789 (GRCm39) nonsense probably null
R8894:Magi1 UTSW 6 93,663,586 (GRCm39) missense probably benign 0.12
R8974:Magi1 UTSW 6 93,674,223 (GRCm39) missense probably damaging 1.00
R9225:Magi1 UTSW 6 93,762,511 (GRCm39) missense possibly damaging 0.64
R9277:Magi1 UTSW 6 93,920,234 (GRCm39) missense possibly damaging 0.48
R9300:Magi1 UTSW 6 93,724,209 (GRCm39) missense probably damaging 1.00
R9393:Magi1 UTSW 6 93,659,890 (GRCm39) missense probably benign 0.27
R9402:Magi1 UTSW 6 94,260,278 (GRCm39) missense probably benign 0.00
R9432:Magi1 UTSW 6 93,660,058 (GRCm39) missense probably damaging 1.00
R9567:Magi1 UTSW 6 93,659,931 (GRCm39) critical splice donor site probably null
R9567:Magi1 UTSW 6 93,655,431 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATCTGACTACTTGACACCTAGGC -3'
(R):5'- GTGCGTGCAAAGTCAGGATG -3'

Sequencing Primer
(F):5'- GACACCTAGGCCTTTTCGATTAAGAG -3'
(R):5'- TCAGGATGGGGAGAGATGCC -3'
Posted On 2019-10-17