Incidental Mutation 'R7537:Usp29'
ID583648
Institutional Source Beutler Lab
Gene Symbol Usp29
Ensembl Gene ENSMUSG00000051527
Gene Nameubiquitin specific peptidase 29
SynonymsOcat
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7537 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6730578-6967219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 6961220 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 21 (T21P)
Ref Sequence ENSEMBL: ENSMUSP00000143283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054055] [ENSMUST00000197117] [ENSMUST00000198068] [ENSMUST00000200535]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054055
AA Change: T21P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062349
Gene: ENSMUSG00000051527
AA Change: T21P

DomainStartEndE-ValueType
Pfam:UCH_N 1 107 6.1e-37 PFAM
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
Pfam:UCH 288 823 6.1e-53 PFAM
Pfam:UCH_1 289 615 2.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197117
AA Change: T21P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143283
Gene: ENSMUSG00000051527
AA Change: T21P

DomainStartEndE-ValueType
PDB:3U12|B 11 73 3e-7 PDB
low complexity region 82 95 N/A INTRINSIC
low complexity region 169 186 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198068
AA Change: T21P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143267
Gene: ENSMUSG00000051527
AA Change: T21P

DomainStartEndE-ValueType
PDB:3U12|B 11 123 3e-6 PDB
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 7.9e-52 PFAM
Pfam:UCH_1 296 626 9.6e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200535
AA Change: T21P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143769
Gene: ENSMUSG00000051527
AA Change: T21P

DomainStartEndE-ValueType
Pfam:UCH_N 8 114 8.3e-34 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
Pfam:UCH 295 830 2.8e-51 PFAM
Pfam:UCH_1 296 622 1.1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Pkd1l3 CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA 8: 109,623,788 probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Usp29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Usp29 APN 7 6962282 missense probably benign 0.06
IGL01588:Usp29 APN 7 6962611 missense probably benign 0.33
IGL02032:Usp29 APN 7 6962018 missense probably benign 0.41
IGL02052:Usp29 APN 7 6962526 missense probably benign 0.06
IGL02331:Usp29 APN 7 6962156 missense probably benign 0.16
IGL02551:Usp29 APN 7 6963353 unclassified probably null
IGL02573:Usp29 APN 7 6962618 unclassified probably null
IGL02894:Usp29 APN 7 6961634 missense probably benign 0.00
R0029:Usp29 UTSW 7 6961581 missense probably damaging 0.99
R0142:Usp29 UTSW 7 6962335 missense probably benign 0.12
R0452:Usp29 UTSW 7 6963182 missense possibly damaging 0.82
R0680:Usp29 UTSW 7 6962885 missense possibly damaging 0.92
R1161:Usp29 UTSW 7 6961530 missense probably damaging 1.00
R2391:Usp29 UTSW 7 6963771 unclassified probably null
R3104:Usp29 UTSW 7 6962053 nonsense probably null
R4119:Usp29 UTSW 7 6962806 missense probably benign 0.03
R4490:Usp29 UTSW 7 6961950 missense possibly damaging 0.68
R4598:Usp29 UTSW 7 6962480 missense probably benign 0.06
R4606:Usp29 UTSW 7 6963357 unclassified probably null
R4670:Usp29 UTSW 7 6962915 missense possibly damaging 0.91
R4777:Usp29 UTSW 7 6962748 missense probably benign 0.07
R4783:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4785:Usp29 UTSW 7 6961391 missense probably damaging 1.00
R4896:Usp29 UTSW 7 6962159 missense probably benign 0.29
R4915:Usp29 UTSW 7 6961505 missense probably benign
R4944:Usp29 UTSW 7 6961928 missense possibly damaging 0.92
R5004:Usp29 UTSW 7 6962159 missense probably benign 0.29
R5171:Usp29 UTSW 7 6962075 missense probably damaging 0.99
R5268:Usp29 UTSW 7 6961584 missense probably damaging 0.98
R5572:Usp29 UTSW 7 6962192 missense probably benign 0.12
R5933:Usp29 UTSW 7 6961745 missense probably benign
R6694:Usp29 UTSW 7 6962277 missense probably benign 0.03
R7389:Usp29 UTSW 7 6963458 missense possibly damaging 0.82
R7446:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7447:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
R7535:Usp29 UTSW 7 6961220 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGACTAAAAGCTGATGGTGGTC -3'
(R):5'- AAGGATGTGTCGTCTCTCAAAG -3'

Sequencing Primer
(F):5'- GGTCAGTTAAGAGTTTAACCAGCCC -3'
(R):5'- GTGTCGTCTCTCAAAGTTAAATCCAG -3'
Posted On2019-10-17