Incidental Mutation 'R7537:Nlrp4b'
ID583649
Institutional Source Beutler Lab
Gene Symbol Nlrp4b
Ensembl Gene ENSMUSG00000034087
Gene NameNLR family, pyrin domain containing 4B
SynonymsNalp4b, Nalp-gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location10687789-10730168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10714889 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 340 (M340V)
Ref Sequence ENSEMBL: ENSMUSP00000043881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047809] [ENSMUST00000117413] [ENSMUST00000132990] [ENSMUST00000211069]
Predicted Effect probably benign
Transcript: ENSMUST00000047809
AA Change: M340V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000043881
Gene: ENSMUSG00000034087
AA Change: M340V

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 7.9e-40 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117413
AA Change: M340V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113095
Gene: ENSMUSG00000034087
AA Change: M340V

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 3.3e-39 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132990
SMART Domains Protein: ENSMUSP00000115831
Gene: ENSMUSG00000034087

DomainStartEndE-ValueType
low complexity region 153 168 N/A INTRINSIC
LRR 316 343 4.9e0 SMART
LRR 345 372 1.97e0 SMART
LRR 373 400 1.13e-4 SMART
LRR 402 429 1.93e1 SMART
LRR 430 457 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211069
Predicted Effect probably benign
Transcript: ENSMUST00000211258
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Nlrp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Nlrp4b APN 7 10714955 missense possibly damaging 0.68
IGL01456:Nlrp4b APN 7 10714223 missense probably benign 0.26
IGL01537:Nlrp4b APN 7 10714991 missense probably damaging 1.00
IGL02539:Nlrp4b APN 7 10714428 missense probably damaging 0.96
IGL02730:Nlrp4b APN 7 10714758 missense probably damaging 1.00
IGL02871:Nlrp4b APN 7 10715265 missense probably benign 0.26
IGL03008:Nlrp4b APN 7 10714589 missense probably benign 0.00
IGL03109:Nlrp4b APN 7 10714946 missense probably damaging 1.00
IGL03251:Nlrp4b APN 7 10714500 missense probably benign 0.01
IGL03354:Nlrp4b APN 7 10714538 missense probably damaging 0.99
R0052:Nlrp4b UTSW 7 10725962 nonsense probably null
R0348:Nlrp4b UTSW 7 10715181 missense possibly damaging 0.60
R0564:Nlrp4b UTSW 7 10714658 missense probably benign 0.15
R0573:Nlrp4b UTSW 7 10714215 missense probably benign 0.01
R0581:Nlrp4b UTSW 7 10714530 missense probably damaging 1.00
R1201:Nlrp4b UTSW 7 10715436 missense possibly damaging 0.64
R1541:Nlrp4b UTSW 7 10725052 missense possibly damaging 0.91
R1771:Nlrp4b UTSW 7 10718593 missense probably damaging 0.96
R1781:Nlrp4b UTSW 7 10715339 missense probably benign 0.13
R1833:Nlrp4b UTSW 7 10725936 missense probably benign 0.00
R2405:Nlrp4b UTSW 7 10714728 missense probably benign 0.08
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2873:Nlrp4b UTSW 7 10710243 nonsense probably null
R2904:Nlrp4b UTSW 7 10714367 missense probably damaging 1.00
R3410:Nlrp4b UTSW 7 10715529 missense probably damaging 1.00
R3714:Nlrp4b UTSW 7 10714881 missense probably benign 0.04
R3982:Nlrp4b UTSW 7 10714431 missense possibly damaging 0.95
R4668:Nlrp4b UTSW 7 10714733 missense possibly damaging 0.66
R4690:Nlrp4b UTSW 7 10719203 missense probably benign 0.00
R4857:Nlrp4b UTSW 7 10715298 missense probably benign 0.05
R5247:Nlrp4b UTSW 7 10714218 missense probably benign 0.21
R5381:Nlrp4b UTSW 7 10715245 nonsense probably null
R5529:Nlrp4b UTSW 7 10714946 missense possibly damaging 0.91
R5589:Nlrp4b UTSW 7 10715585 missense probably benign 0.34
R5770:Nlrp4b UTSW 7 10715487 missense probably benign 0.00
R5990:Nlrp4b UTSW 7 10714491 missense possibly damaging 0.61
R6049:Nlrp4b UTSW 7 10714713 nonsense probably null
R6329:Nlrp4b UTSW 7 10724920 missense probably benign 0.16
R6377:Nlrp4b UTSW 7 10715412 missense probably benign 0.00
R7107:Nlrp4b UTSW 7 10715217 missense probably damaging 0.96
R7209:Nlrp4b UTSW 7 10710370 missense probably benign 0.01
R7237:Nlrp4b UTSW 7 10715216 missense probably benign 0.12
R7793:Nlrp4b UTSW 7 10725074 missense probably benign 0.00
R8138:Nlrp4b UTSW 7 10715531 missense probably benign 0.01
R8190:Nlrp4b UTSW 7 10714392 missense probably damaging 0.96
R8326:Nlrp4b UTSW 7 10718544 missense probably benign 0.05
R8353:Nlrp4b UTSW 7 10715601 missense probably damaging 0.99
R8417:Nlrp4b UTSW 7 10725953 nonsense probably null
R8453:Nlrp4b UTSW 7 10715601 missense probably damaging 0.99
X0063:Nlrp4b UTSW 7 10729587 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGAAGGACTGGATTGAGTACAC -3'
(R):5'- GTGTGGGGATGTCAGAATCC -3'

Sequencing Primer
(F):5'- CAAATGTGAGAACAATAACCGGATTC -3'
(R):5'- GGGATGTCAGAATCCATGATCCC -3'
Posted On2019-10-17