Mutagenetix > Incidental Mutation

Incidental Mutation 'R7537:Man2b1'

583655

Institutional Source

Beutler Lab

Gene Symbol

Man2b1

Ensembl Gene

ENSMUSG00000005142

Gene Name

mannosidase 2, alpha B1

Synonyms

lysosomal alpha-mannosidase

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7537 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85083270-85098282 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 85090965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 358 (C358*)

Ref Sequence

ENSEMBL: ENSMUSP00000034121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034121] [ENSMUST00000209361]

AlphaFold

O09159

Predicted Effect

probably null
Transcript: ENSMUST00000034121
AA Change: C358*

SMART Domains

Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142
AA Change: C358*

Domain	Start	End	E-Value	Type
low complexity region	40	51	N/A	INTRINSIC
Pfam:Glyco_hydro_38	64	381	2.7e-96	PFAM
Alpha-mann_mid	386	465	4.25e-23	SMART
Pfam:Glyco_hydro_38C	510	1002	6.2e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000209361

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes terminal, non-reducing alpha-D-mannose residues in alpha-D-mannosides. Its activity is necessary for the catabolism of N-linked carbohydrates released during glycoprotein turnover and it is member of family 38 of glycosyl hydrolases. The full length protein is processed in two steps. First, a 49 aa leader sequence is cleaved off and the remainder of the protein is processed into 3 peptides of 70 kDa, 42 kDa (D) and 13/15 kDa (E). Next, the 70 kDa peptide is further processed into three peptides (A, B and C). The A, B and C peptides are disulfide-linked. Defects in this gene have been associated with lysosomal alpha-mannosidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show urinary oligosaccharide excretion, storage of neutral sugars, oligosaccharide buildup in spleen, kidney, liver, testis and brain, clear vacuoles and axonal spheroids in CNS, PNS and other cell types, behavioralchanges, and enhanced long-term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,173,988	L2229P	possibly damaging	Het
Acaca	T	A	11: 84,260,634	M786K	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adap1	T	G	5: 139,293,173	E117D	possibly damaging	Het
Ap5z1	T	C	5: 142,477,298	S746P	probably benign	Het
Appl2	A	G	10: 83,617,428	I208T	possibly damaging	Het
Astn1	G	A	1: 158,667,638		probably null	Het
Astn1	A	G	1: 158,505,386	E346G	possibly damaging	Het
Atp23	T	A	10: 126,868,725	I180L	unknown	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Cdh23	A	T	10: 60,384,945	I1340N	probably benign	Het
Cdh8	G	A	8: 99,098,885	Q493*	probably null	Het
Ces1g	T	C	8: 93,319,827	I357V	probably benign	Het
Ddx46	A	G	13: 55,650,478	D226G	probably damaging	Het
Eea1	C	T	10: 95,994,905	Q143*	probably null	Het
Erlin2	G	T	8: 27,031,772		probably null	Het
Fat3	T	A	9: 15,938,319	D3929V	probably damaging	Het
Flt3	T	C	5: 147,334,437	D898G	probably damaging	Het
Gm16519	A	G	17: 70,929,356	N100S	probably benign	Het
Gnl1	A	G	17: 35,988,536	H533R	probably damaging	Het
Gphn	A	G	12: 78,504,680	T301A	possibly damaging	Het
Herc2	C	T	7: 56,219,779	R4295*	probably null	Het
Insm2	T	C	12: 55,599,518	S16P	possibly damaging	Het
Jak2	C	T	19: 29,298,637	T778I	probably benign	Het
Lrriq3	A	G	3: 155,101,097	T128A	probably damaging	Het
Lst1	A	G	17: 35,186,944		probably null	Het
Magi1	G	T	6: 93,708,110	Y762*	probably null	Het
Mga	T	C	2: 119,935,551	V1432A	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Morc2a	C	T	11: 3,683,566	Q587*	probably null	Het
Mrc2	T	C	11: 105,292,797	I4T	probably benign	Het
Muc16	C	A	9: 18,638,135	V5621F	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myo3b	A	G	2: 70,217,169	R340G	probably benign	Het
Nipal3	T	C	4: 135,490,937	Y34C	probably damaging	Het
Nktr	T	A	9: 121,749,279	D804E	unknown	Het
Nlrp4b	A	G	7: 10,714,889	M340V	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr385	T	A	11: 73,589,268	T157S	probably benign	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr701	G	A	7: 106,818,374	C97Y	probably damaging	Het
Pard3	T	A	8: 127,610,582	N1271K	probably damaging	Het
Pcdhb11	A	T	18: 37,421,619	M1L	possibly damaging	Het
Pclo	T	C	5: 14,682,104	V3540A	unknown	Het
Pemt	A	G	11: 59,976,844	F154S	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rnpc3	G	T	3: 113,613,832	T376K	probably benign	Het
Rpe65	A	G	3: 159,604,609	Y143C	probably damaging	Het
Sbk2	T	C	7: 4,963,149	E12G	probably benign	Het
Slc2a5	T	C	4: 150,129,069	I106T	possibly damaging	Het
Snx13	A	G	12: 35,085,982	D92G	probably damaging	Het
Sorl1	C	T	9: 41,980,688	V1889I	probably benign	Het
Spag17	A	T	3: 99,939,247	N29I	possibly damaging	Het
Speg	T	C	1: 75,401,464	V878A	probably damaging	Het
Timp4	A	G	6: 115,250,460	S53P	probably damaging	Het
Tssk1	G	T	16: 17,895,084	E244D	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Vmn2r85	A	T	10: 130,422,866	V440E	probably benign	Het
Wdr59	T	C	8: 111,490,369	D270G		Het
Zbbx	G	A	3: 75,085,519	P223S	probably damaging	Het
Zfp936	T	A	7: 43,189,815	C235*	probably null	Het
Zranb3	A	T	1: 128,032,847		probably null	Het

Other mutations in Man2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00588:Man2b1	APN	8	85084638	splice site	probably null
IGL00671:Man2b1	APN	8	85093938	missense	probably damaging	0.98
IGL01538:Man2b1	APN	8	85097430	missense	probably benign	0.00
dateline	UTSW	8	85084737	missense	probably damaging	1.00
greenwich	UTSW	8	85085456	nonsense	probably null
longitude	UTSW	8	85095144	nonsense	probably null
meridian	UTSW	8	85096752	missense	probably damaging	1.00
R0018:Man2b1	UTSW	8	85097489	missense	probably damaging	1.00
R0302:Man2b1	UTSW	8	85093016	missense	probably damaging	1.00
R0574:Man2b1	UTSW	8	85096776	missense	probably benign
R0727:Man2b1	UTSW	8	85091526	missense	probably damaging	1.00
R0837:Man2b1	UTSW	8	85096829	missense	possibly damaging	0.92
R1087:Man2b1	UTSW	8	85095171	missense	probably damaging	1.00
R1471:Man2b1	UTSW	8	85086845	missense	probably damaging	0.99
R1745:Man2b1	UTSW	8	85093934	missense	probably damaging	1.00
R1903:Man2b1	UTSW	8	85086822	missense	probably damaging	1.00
R2026:Man2b1	UTSW	8	85095335	missense	probably damaging	0.99
R2071:Man2b1	UTSW	8	85085384	missense	possibly damaging	0.90
R2120:Man2b1	UTSW	8	85093024	splice site	probably benign
R3897:Man2b1	UTSW	8	85096948	splice site	probably benign
R3971:Man2b1	UTSW	8	85085391	missense	probably damaging	0.98
R3972:Man2b1	UTSW	8	85085391	missense	probably damaging	0.98
R4096:Man2b1	UTSW	8	85084737	missense	probably damaging	1.00
R4497:Man2b1	UTSW	8	85090936	missense	probably benign	0.22
R5183:Man2b1	UTSW	8	85095784	missense	probably damaging	1.00
R5191:Man2b1	UTSW	8	85084459	missense	probably damaging	1.00
R5644:Man2b1	UTSW	8	85094210	missense	possibly damaging	0.61
R6027:Man2b1	UTSW	8	85096752	missense	probably damaging	1.00
R6291:Man2b1	UTSW	8	85097046	missense	probably benign	0.44
R6341:Man2b1	UTSW	8	85095399	missense	probably damaging	1.00
R6467:Man2b1	UTSW	8	85097447	missense	possibly damaging	0.91
R6622:Man2b1	UTSW	8	85084479	missense	probably damaging	1.00
R6624:Man2b1	UTSW	8	85096853	missense	probably benign	0.01
R6631:Man2b1	UTSW	8	85086811	splice site	probably null
R6828:Man2b1	UTSW	8	85086919	missense	possibly damaging	0.88
R6983:Man2b1	UTSW	8	85091071	splice site	probably null
R7159:Man2b1	UTSW	8	85087280	missense	probably benign	0.09
R7267:Man2b1	UTSW	8	85087175	missense	probably damaging	1.00
R7786:Man2b1	UTSW	8	85085456	nonsense	probably null
R8022:Man2b1	UTSW	8	85095613	missense	probably damaging	1.00
R8069:Man2b1	UTSW	8	85097045	missense	probably benign	0.03
R8251:Man2b1	UTSW	8	85095129	missense	probably damaging	0.99
R8406:Man2b1	UTSW	8	85096278	missense	probably damaging	1.00
R8464:Man2b1	UTSW	8	85094143	missense	possibly damaging	0.55
R8701:Man2b1	UTSW	8	85095153	missense	probably damaging	1.00
R8792:Man2b1	UTSW	8	85095144	nonsense	probably null
R8891:Man2b1	UTSW	8	85084455	missense	probably damaging	1.00
R8930:Man2b1	UTSW	8	85095393	missense	probably damaging	1.00
R8932:Man2b1	UTSW	8	85095393	missense	probably damaging	1.00
R8953:Man2b1	UTSW	8	85091910	missense	probably benign	0.36
R9059:Man2b1	UTSW	8	85091526	missense	probably damaging	1.00
Z1176:Man2b1	UTSW	8	85093938	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTGGGGCTAAAATCCACTTATCAG -3'
(R):5'- GTTGTAACTGAGGCGCTCATAGC -3'

Sequencing Primer
(F):5'- CTATTGGATTCCTGTGGGC -3'
(R):5'- CTGGCCTGCTGGAAAAATAGCC -3'

Posted On

2019-10-17