Mutagenetix > Incidental Mutation

Incidental Mutation 'R7537:Bean1'

583657

Institutional Source

Beutler Lab

Gene Symbol

Bean1

Ensembl Gene

ENSMUSG00000031872

Gene Name

brain expressed, associated with Nedd4, 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7537 (G1)

Quality Score

214.458

Status

Validated

Chromosome

Chromosomal Location

104170442-104219122 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CT to C at 104182032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148571 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]

AlphaFold

Q9EQG5

Predicted Effect

probably benign
Transcript: ENSMUST00000093245

SMART Domains

Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153288

Predicted Effect

probably benign
Transcript: ENSMUST00000164076

SMART Domains

Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
low complexity region	156	171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167633

SMART Domains

Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
transmembrane domain	38	60	N/A	INTRINSIC
low complexity region	70	90	N/A	INTRINSIC
low complexity region	217	232	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171018

SMART Domains

Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872

Domain	Start	End	E-Value	Type
transmembrane domain	72	94	N/A	INTRINSIC
low complexity region	104	124	N/A	INTRINSIC
low complexity region	288	303	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000212979

Predicted Effect

probably benign
Transcript: ENSMUST00000213077

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,173,988	L2229P	possibly damaging	Het
Acaca	T	A	11: 84,260,634	M786K	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adap1	T	G	5: 139,293,173	E117D	possibly damaging	Het
Ap5z1	T	C	5: 142,477,298	S746P	probably benign	Het
Appl2	A	G	10: 83,617,428	I208T	possibly damaging	Het
Astn1	G	A	1: 158,667,638		probably null	Het
Astn1	A	G	1: 158,505,386	E346G	possibly damaging	Het
Atp23	T	A	10: 126,868,725	I180L	unknown	Het
Cdh23	A	T	10: 60,384,945	I1340N	probably benign	Het
Cdh8	G	A	8: 99,098,885	Q493*	probably null	Het
Ces1g	T	C	8: 93,319,827	I357V	probably benign	Het
Ddx46	A	G	13: 55,650,478	D226G	probably damaging	Het
Eea1	C	T	10: 95,994,905	Q143*	probably null	Het
Erlin2	G	T	8: 27,031,772		probably null	Het
Fat3	T	A	9: 15,938,319	D3929V	probably damaging	Het
Flt3	T	C	5: 147,334,437	D898G	probably damaging	Het
Gm16519	A	G	17: 70,929,356	N100S	probably benign	Het
Gnl1	A	G	17: 35,988,536	H533R	probably damaging	Het
Gphn	A	G	12: 78,504,680	T301A	possibly damaging	Het
Herc2	C	T	7: 56,219,779	R4295*	probably null	Het
Insm2	T	C	12: 55,599,518	S16P	possibly damaging	Het
Jak2	C	T	19: 29,298,637	T778I	probably benign	Het
Lrriq3	A	G	3: 155,101,097	T128A	probably damaging	Het
Lst1	A	G	17: 35,186,944		probably null	Het
Magi1	G	T	6: 93,708,110	Y762*	probably null	Het
Man2b1	T	A	8: 85,090,965	C358*	probably null	Het
Mga	T	C	2: 119,935,551	V1432A	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Morc2a	C	T	11: 3,683,566	Q587*	probably null	Het
Mrc2	T	C	11: 105,292,797	I4T	probably benign	Het
Muc16	C	A	9: 18,638,135	V5621F	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myo3b	A	G	2: 70,217,169	R340G	probably benign	Het
Nipal3	T	C	4: 135,490,937	Y34C	probably damaging	Het
Nktr	T	A	9: 121,749,279	D804E	unknown	Het
Nlrp4b	A	G	7: 10,714,889	M340V	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr385	T	A	11: 73,589,268	T157S	probably benign	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr701	G	A	7: 106,818,374	C97Y	probably damaging	Het
Pard3	T	A	8: 127,610,582	N1271K	probably damaging	Het
Pcdhb11	A	T	18: 37,421,619	M1L	possibly damaging	Het
Pclo	T	C	5: 14,682,104	V3540A	unknown	Het
Pemt	A	G	11: 59,976,844	F154S	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rnpc3	G	T	3: 113,613,832	T376K	probably benign	Het
Rpe65	A	G	3: 159,604,609	Y143C	probably damaging	Het
Sbk2	T	C	7: 4,963,149	E12G	probably benign	Het
Slc2a5	T	C	4: 150,129,069	I106T	possibly damaging	Het
Snx13	A	G	12: 35,085,982	D92G	probably damaging	Het
Sorl1	C	T	9: 41,980,688	V1889I	probably benign	Het
Spag17	A	T	3: 99,939,247	N29I	possibly damaging	Het
Speg	T	C	1: 75,401,464	V878A	probably damaging	Het
Timp4	A	G	6: 115,250,460	S53P	probably damaging	Het
Tssk1	G	T	16: 17,895,084	E244D	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Vmn2r85	A	T	10: 130,422,866	V440E	probably benign	Het
Wdr59	T	C	8: 111,490,369	D270G		Het
Zbbx	G	A	3: 75,085,519	P223S	probably damaging	Het
Zfp936	T	A	7: 43,189,815	C235*	probably null	Het
Zranb3	A	T	1: 128,032,847		probably null	Het

Other mutations in Bean1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02016:Bean1	APN	8	104210918	missense	possibly damaging	0.90
R0135:Bean1	UTSW	8	104217175	missense	probably damaging	1.00
R0490:Bean1	UTSW	8	104215028	missense	possibly damaging	0.76
R1319:Bean1	UTSW	8	104217224	missense	probably benign
R1920:Bean1	UTSW	8	104211110	missense	possibly damaging	0.92
R2513:Bean1	UTSW	8	104182011	missense	probably benign	0.04
R3980:Bean1	UTSW	8	104211098	missense	possibly damaging	0.92
R4209:Bean1	UTSW	8	104213934	start codon destroyed	probably null	0.04
R4369:Bean1	UTSW	8	104217110	missense	probably damaging	1.00
R4516:Bean1	UTSW	8	104215154	missense	probably damaging	1.00
R4542:Bean1	UTSW	8	104210959	missense	probably damaging	1.00
R4663:Bean1	UTSW	8	104211167	missense	probably damaging	1.00
R4962:Bean1	UTSW	8	104216974	missense	probably damaging	1.00
R5221:Bean1	UTSW	8	104215152	missense	probably damaging	1.00
R6288:Bean1	UTSW	8	104210990	missense	probably damaging	1.00
R6588:Bean1	UTSW	8	104182032	frame shift	probably null
R6615:Bean1	UTSW	8	104182032	frame shift	probably null
R6994:Bean1	UTSW	8	104182032	frame shift	probably null
R7359:Bean1	UTSW	8	104182032	frame shift	probably null
R7451:Bean1	UTSW	8	104213996	missense	probably benign	0.01
R7454:Bean1	UTSW	8	104211026	missense	probably damaging	1.00
R7473:Bean1	UTSW	8	104182032	frame shift	probably null
R7826:Bean1	UTSW	8	104182032	frame shift	probably null
R8034:Bean1	UTSW	8	104182032	frame shift	probably null
R8418:Bean1	UTSW	8	104182032	frame shift	probably null
R8789:Bean1	UTSW	8	104182032	frame shift	probably null
R8885:Bean1	UTSW	8	104182120	critical splice donor site	probably null
R8888:Bean1	UTSW	8	104182032	frame shift	probably null
R8892:Bean1	UTSW	8	104216978	missense	probably damaging	1.00
R8896:Bean1	UTSW	8	104182032	frame shift	probably null
R8992:Bean1	UTSW	8	104182032	frame shift	probably null
R9015:Bean1	UTSW	8	104182032	frame shift	probably null
R9113:Bean1	UTSW	8	104213925	missense	probably benign	0.00
R9122:Bean1	UTSW	8	104182032	frame shift	probably null
R9135:Bean1	UTSW	8	104182032	frame shift	probably null
R9151:Bean1	UTSW	8	104182032	frame shift	probably null
R9255:Bean1	UTSW	8	104182032	frame shift	probably null
R9340:Bean1	UTSW	8	104182107	missense	probably damaging	0.99
R9363:Bean1	UTSW	8	104182032	frame shift	probably null
R9417:Bean1	UTSW	8	104182032	frame shift	probably null
R9537:Bean1	UTSW	8	104182032	frame shift	probably null
R9566:Bean1	UTSW	8	104182032	frame shift	probably null
R9731:Bean1	UTSW	8	104182032	frame shift	probably null
RF054:Bean1	UTSW	8	104182032	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGACCTCAATACCCCATGTG -3'
(R):5'- TCCACACTAGCCTTGGTCAG -3'

Sequencing Primer
(F):5'- GACCTCAATACCCCATGTGATATTC -3'
(R):5'- CTTGGTCAGGCTCAGTGC -3'

Posted On

2019-10-17