Incidental Mutation 'R7537:Bean1'
ID583657
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Namebrain expressed, associated with Nedd4, 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7537 (G1)
Quality Score214.458
Status Validated
Chromosome8
Chromosomal Location104170442-104219122 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CT to C at 104182032 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
Predicted Effect probably benign
Transcript: ENSMUST00000093245
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153288
Predicted Effect probably benign
Transcript: ENSMUST00000164076
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167633
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171018
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212979
Predicted Effect probably benign
Transcript: ENSMUST00000213077
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104210918 missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104217175 missense probably damaging 1.00
R0490:Bean1 UTSW 8 104215028 missense possibly damaging 0.76
R1319:Bean1 UTSW 8 104217224 missense probably benign
R1920:Bean1 UTSW 8 104211110 missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104182011 missense probably benign 0.04
R3980:Bean1 UTSW 8 104211098 missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104213934 start codon destroyed probably null 0.04
R4369:Bean1 UTSW 8 104217110 missense probably damaging 1.00
R4516:Bean1 UTSW 8 104215154 missense probably damaging 1.00
R4542:Bean1 UTSW 8 104210959 missense probably damaging 1.00
R4663:Bean1 UTSW 8 104211167 missense probably damaging 1.00
R4962:Bean1 UTSW 8 104216974 missense probably damaging 1.00
R5221:Bean1 UTSW 8 104215152 missense probably damaging 1.00
R6288:Bean1 UTSW 8 104210990 missense probably damaging 1.00
R6588:Bean1 UTSW 8 104182032 frame shift probably null
R6615:Bean1 UTSW 8 104182032 frame shift probably null
R6994:Bean1 UTSW 8 104182032 frame shift probably null
R7359:Bean1 UTSW 8 104182032 frame shift probably null
R7451:Bean1 UTSW 8 104213996 missense probably benign 0.01
R7454:Bean1 UTSW 8 104211026 missense probably damaging 1.00
R7473:Bean1 UTSW 8 104182032 frame shift probably null
R7826:Bean1 UTSW 8 104182032 frame shift probably null
R8034:Bean1 UTSW 8 104182032 frame shift probably null
R8418:Bean1 UTSW 8 104182032 frame shift probably null
RF054:Bean1 UTSW 8 104182032 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTGACCTCAATACCCCATGTG -3'
(R):5'- TCCACACTAGCCTTGGTCAG -3'

Sequencing Primer
(F):5'- GACCTCAATACCCCATGTGATATTC -3'
(R):5'- CTTGGTCAGGCTCAGTGC -3'
Posted On2019-10-17