Incidental Mutation 'R7537:Pard3'
ID 583660
Institutional Source Beutler Lab
Gene Symbol Pard3
Ensembl Gene ENSMUSG00000025812
Gene Name par-3 family cell polarity regulator
Synonyms Par3, Pard3a, ASIP, D8Ertd580e, PAR-3
MMRRC Submission 045609-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7537 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 127790643-128338767 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128337063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1271 (N1271K)
Ref Sequence ENSEMBL: ENSMUSP00000125453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026921] [ENSMUST00000160272] [ENSMUST00000160766] [ENSMUST00000162309] [ENSMUST00000162536]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026921
AA Change: N1256K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026921
Gene: ENSMUSG00000025812
AA Change: N1256K

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.1e-72 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 3e-10 PDB
low complexity region 863 875 N/A INTRINSIC
low complexity region 892 902 N/A INTRINSIC
low complexity region 921 950 N/A INTRINSIC
low complexity region 965 1005 N/A INTRINSIC
low complexity region 1162 1200 N/A INTRINSIC
low complexity region 1264 1281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160272
AA Change: N1271K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125453
Gene: ENSMUSG00000025812
AA Change: N1271K

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.7e-60 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 878 890 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 936 965 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1177 1215 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160766
AA Change: N1184K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124533
Gene: ENSMUSG00000025812
AA Change: N1184K

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
low complexity region 820 830 N/A INTRINSIC
low complexity region 849 878 N/A INTRINSIC
low complexity region 893 933 N/A INTRINSIC
low complexity region 1090 1128 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162309
AA Change: N1270K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124282
Gene: ENSMUSG00000025812
AA Change: N1270K

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 877 889 N/A INTRINSIC
low complexity region 906 916 N/A INTRINSIC
low complexity region 935 964 N/A INTRINSIC
low complexity region 979 1019 N/A INTRINSIC
low complexity region 1176 1214 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162536
AA Change: N1226K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125212
Gene: ENSMUSG00000025812
AA Change: N1226K

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 555 640 9.87e-14 SMART
low complexity region 727 737 N/A INTRINSIC
PDB:4DC2|Z 766 793 3e-10 PDB
low complexity region 833 845 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
low complexity region 891 920 N/A INTRINSIC
low complexity region 935 975 N/A INTRINSIC
low complexity region 1132 1170 N/A INTRINSIC
low complexity region 1234 1251 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124718
Gene: ENSMUSG00000025812
AA Change: N1260K

DomainStartEndE-ValueType
Pfam:DUF3534 21 166 1.4e-60 PFAM
low complexity region 254 266 N/A INTRINSIC
PDZ 302 381 2.34e-6 SMART
low complexity region 451 460 N/A INTRINSIC
PDZ 489 568 4.1e-20 SMART
PDZ 619 704 9.87e-14 SMART
low complexity region 791 801 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 926 955 N/A INTRINSIC
low complexity region 970 1010 N/A INTRINSIC
low complexity region 1167 1205 N/A INTRINSIC
low complexity region 1269 1286 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E12.5 associated with growth retardation, abnormal heart development, and abnormal epicardial cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 121,967,637 (GRCm39) L2229P possibly damaging Het
Acaca T A 11: 84,151,460 (GRCm39) M786K probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adap1 T G 5: 139,278,928 (GRCm39) E117D possibly damaging Het
Ap5z1 T C 5: 142,463,053 (GRCm39) S746P probably benign Het
Appl2 A G 10: 83,453,292 (GRCm39) I208T possibly damaging Het
Astn1 A G 1: 158,332,956 (GRCm39) E346G possibly damaging Het
Astn1 G A 1: 158,495,208 (GRCm39) probably null Het
Atp23 T A 10: 126,704,594 (GRCm39) I180L unknown Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cdh23 A T 10: 60,220,724 (GRCm39) I1340N probably benign Het
Cdh8 G A 8: 99,825,517 (GRCm39) Q493* probably null Het
Ces1g T C 8: 94,046,455 (GRCm39) I357V probably benign Het
Ddx46 A G 13: 55,798,291 (GRCm39) D226G probably damaging Het
Eea1 C T 10: 95,830,767 (GRCm39) Q143* probably null Het
Erlin2 G T 8: 27,521,800 (GRCm39) probably null Het
Fat3 T A 9: 15,849,615 (GRCm39) D3929V probably damaging Het
Flt3 T C 5: 147,271,247 (GRCm39) D898G probably damaging Het
Gm16519 A G 17: 71,236,351 (GRCm39) N100S probably benign Het
Gnl1 A G 17: 36,299,428 (GRCm39) H533R probably damaging Het
Gphn A G 12: 78,551,454 (GRCm39) T301A possibly damaging Het
Herc2 C T 7: 55,869,527 (GRCm39) R4295* probably null Het
Insm2 T C 12: 55,646,303 (GRCm39) S16P possibly damaging Het
Jak2 C T 19: 29,276,037 (GRCm39) T778I probably benign Het
Lrriq3 A G 3: 154,806,734 (GRCm39) T128A probably damaging Het
Lst1 A G 17: 35,405,920 (GRCm39) probably null Het
Magi1 G T 6: 93,685,091 (GRCm39) Y762* probably null Het
Man2b1 T A 8: 85,817,594 (GRCm39) C358* probably null Het
Mga T C 2: 119,766,032 (GRCm39) V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Morc2a C T 11: 3,633,566 (GRCm39) Q587* probably null Het
Mrc2 T C 11: 105,183,623 (GRCm39) I4T probably benign Het
Muc16 C A 9: 18,549,431 (GRCm39) V5621F probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myo3b A G 2: 70,047,513 (GRCm39) R340G probably benign Het
Nipal3 T C 4: 135,218,248 (GRCm39) Y34C probably damaging Het
Nktr T A 9: 121,578,345 (GRCm39) D804E unknown Het
Nlrp4b A G 7: 10,448,816 (GRCm39) M340V probably benign Het
Or1e26 T A 11: 73,480,094 (GRCm39) T157S probably benign Het
Or2ag2b G A 7: 106,417,581 (GRCm39) C97Y probably damaging Het
Or56a41 A T 7: 104,741,978 (GRCm39) M16K probably benign Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Pcdhb11 A T 18: 37,554,672 (GRCm39) M1L possibly damaging Het
Pclo T C 5: 14,732,118 (GRCm39) V3540A unknown Het
Pemt A G 11: 59,867,670 (GRCm39) F154S probably damaging Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rnpc3 G T 3: 113,407,481 (GRCm39) T376K probably benign Het
Rpe65 A G 3: 159,310,246 (GRCm39) Y143C probably damaging Het
Sbk2 T C 7: 4,966,148 (GRCm39) E12G probably benign Het
Slc2a5 T C 4: 150,213,526 (GRCm39) I106T possibly damaging Het
Snx13 A G 12: 35,135,981 (GRCm39) D92G probably damaging Het
Sorl1 C T 9: 41,891,984 (GRCm39) V1889I probably benign Het
Spag17 A T 3: 99,846,563 (GRCm39) N29I possibly damaging Het
Speg T C 1: 75,378,108 (GRCm39) V878A probably damaging Het
Timp4 A G 6: 115,227,421 (GRCm39) S53P probably damaging Het
Tssk1 G T 16: 17,712,948 (GRCm39) E244D probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Vmn2r85 A T 10: 130,258,735 (GRCm39) V440E probably benign Het
Wdr59 T C 8: 112,217,001 (GRCm39) D270G Het
Zbbx G A 3: 74,992,826 (GRCm39) P223S probably damaging Het
Zfp936 T A 7: 42,839,239 (GRCm39) C235* probably null Het
Zranb3 A T 1: 127,960,584 (GRCm39) probably null Het
Other mutations in Pard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pard3 APN 8 128,086,299 (GRCm39) splice site probably benign
IGL00484:Pard3 APN 8 128,098,327 (GRCm39) missense probably benign 0.05
IGL00674:Pard3 APN 8 128,115,159 (GRCm39) missense probably damaging 1.00
IGL01471:Pard3 APN 8 128,104,727 (GRCm39) missense probably benign 0.01
IGL01505:Pard3 APN 8 128,050,544 (GRCm39) missense probably damaging 1.00
IGL02252:Pard3 APN 8 128,125,237 (GRCm39) missense probably benign 0.09
IGL02511:Pard3 APN 8 127,888,070 (GRCm39) splice site probably benign
IGL02838:Pard3 APN 8 128,153,128 (GRCm39) missense probably damaging 0.99
IGL02948:Pard3 APN 8 128,032,975 (GRCm39) missense probably benign 0.00
IGL02987:Pard3 APN 8 128,115,972 (GRCm39) missense probably damaging 0.98
IGL03037:Pard3 APN 8 128,032,975 (GRCm39) missense probably benign 0.00
IGL03084:Pard3 APN 8 128,319,573 (GRCm39) missense probably damaging 0.96
BB001:Pard3 UTSW 8 128,137,231 (GRCm39) missense probably benign
BB011:Pard3 UTSW 8 128,137,231 (GRCm39) missense probably benign
R0025:Pard3 UTSW 8 127,888,058 (GRCm39) missense probably damaging 1.00
R0025:Pard3 UTSW 8 127,888,058 (GRCm39) missense probably damaging 1.00
R0029:Pard3 UTSW 8 128,153,239 (GRCm39) splice site probably benign
R0109:Pard3 UTSW 8 128,125,147 (GRCm39) missense probably damaging 1.00
R0309:Pard3 UTSW 8 128,103,378 (GRCm39) splice site probably benign
R0415:Pard3 UTSW 8 128,337,047 (GRCm39) missense probably damaging 1.00
R0507:Pard3 UTSW 8 128,097,967 (GRCm39) splice site probably benign
R1055:Pard3 UTSW 8 128,104,761 (GRCm39) missense probably benign 0.34
R1305:Pard3 UTSW 8 128,032,891 (GRCm39) missense possibly damaging 0.62
R1619:Pard3 UTSW 8 128,106,983 (GRCm39) missense probably benign 0.02
R1855:Pard3 UTSW 8 128,174,293 (GRCm39) splice site probably null
R2001:Pard3 UTSW 8 127,791,097 (GRCm39) splice site probably null
R2060:Pard3 UTSW 8 128,125,085 (GRCm39) missense probably benign 0.05
R2064:Pard3 UTSW 8 128,337,092 (GRCm39) missense probably damaging 1.00
R2113:Pard3 UTSW 8 128,115,018 (GRCm39) missense probably damaging 1.00
R2136:Pard3 UTSW 8 128,103,366 (GRCm39) critical splice donor site probably null
R2224:Pard3 UTSW 8 128,086,257 (GRCm39) missense probably damaging 1.00
R2252:Pard3 UTSW 8 128,337,080 (GRCm39) missense probably damaging 1.00
R3870:Pard3 UTSW 8 128,136,167 (GRCm39) missense probably damaging 1.00
R4154:Pard3 UTSW 8 128,200,877 (GRCm39) missense probably damaging 1.00
R4212:Pard3 UTSW 8 128,336,939 (GRCm39) missense probably benign 0.43
R4243:Pard3 UTSW 8 128,098,128 (GRCm39) missense probably benign 0.09
R4523:Pard3 UTSW 8 128,125,108 (GRCm39) missense probably benign 0.08
R4857:Pard3 UTSW 8 128,050,535 (GRCm39) missense probably damaging 0.98
R4876:Pard3 UTSW 8 128,287,950 (GRCm39) intron probably benign
R4877:Pard3 UTSW 8 128,115,018 (GRCm39) missense probably damaging 1.00
R5197:Pard3 UTSW 8 127,800,040 (GRCm39) splice site probably null
R5215:Pard3 UTSW 8 128,104,745 (GRCm39) missense probably damaging 1.00
R5279:Pard3 UTSW 8 128,186,867 (GRCm39) critical splice donor site probably null
R5349:Pard3 UTSW 8 128,142,224 (GRCm39) missense probably damaging 1.00
R5479:Pard3 UTSW 8 128,096,836 (GRCm39) missense probably damaging 1.00
R5514:Pard3 UTSW 8 128,153,086 (GRCm39) missense probably damaging 1.00
R5681:Pard3 UTSW 8 128,115,914 (GRCm39) missense possibly damaging 0.81
R5934:Pard3 UTSW 8 128,115,819 (GRCm39) missense probably damaging 1.00
R6034:Pard3 UTSW 8 127,791,077 (GRCm39) utr 5 prime probably benign
R6034:Pard3 UTSW 8 127,791,077 (GRCm39) utr 5 prime probably benign
R6187:Pard3 UTSW 8 127,800,023 (GRCm39) missense probably benign 0.00
R6382:Pard3 UTSW 8 128,103,264 (GRCm39) missense probably damaging 1.00
R6774:Pard3 UTSW 8 128,137,228 (GRCm39) missense probably damaging 0.98
R7130:Pard3 UTSW 8 128,142,164 (GRCm39) missense probably damaging 1.00
R7267:Pard3 UTSW 8 128,098,056 (GRCm39) missense probably damaging 0.97
R7358:Pard3 UTSW 8 128,319,573 (GRCm39) missense probably damaging 0.98
R7528:Pard3 UTSW 8 128,329,646 (GRCm39) missense probably damaging 1.00
R7679:Pard3 UTSW 8 128,098,327 (GRCm39) missense probably benign 0.05
R7924:Pard3 UTSW 8 128,137,231 (GRCm39) missense probably benign
R8076:Pard3 UTSW 8 128,142,077 (GRCm39) missense probably damaging 1.00
R8258:Pard3 UTSW 8 128,098,021 (GRCm39) nonsense probably null
R8259:Pard3 UTSW 8 128,098,021 (GRCm39) nonsense probably null
R8345:Pard3 UTSW 8 128,050,549 (GRCm39) missense probably damaging 1.00
R8421:Pard3 UTSW 8 127,867,158 (GRCm39) intron probably benign
R8500:Pard3 UTSW 8 128,186,784 (GRCm39) missense probably damaging 1.00
R8742:Pard3 UTSW 8 128,050,592 (GRCm39) missense possibly damaging 0.85
R8918:Pard3 UTSW 8 128,098,011 (GRCm39) missense probably benign 0.29
R9005:Pard3 UTSW 8 128,003,647 (GRCm39) missense probably damaging 1.00
R9629:Pard3 UTSW 8 128,136,153 (GRCm39) missense possibly damaging 0.94
R9643:Pard3 UTSW 8 128,115,900 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCTAAAGCCTGGAGATTCATCTC -3'
(R):5'- GCATGACACAAAATGCTGCC -3'

Sequencing Primer
(F):5'- ATCCCTGACTGACTTCTTTGC -3'
(R):5'- CCTTCTTTGAGCTCAGGAGTAGAAG -3'
Posted On 2019-10-17