Incidental Mutation 'R7537:Muc16'
ID583663
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18638135 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 5621 (V5621F)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: V5621F

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 intron probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 intron probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7928:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7932:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7967:Muc16 UTSW 9 18642694 missense unknown
R7968:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7969:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7982:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7987:Muc16 UTSW 9 18655650 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGACACCAACTTGAGTAGAC -3'
(R):5'- TCACCAGGTCAAGCAGAATC -3'

Sequencing Primer
(F):5'- CACCAACTTGAGTAGACAATGATG -3'
(R):5'- GGAACACTAATTCTGAAATGGAAACC -3'
Posted On2019-10-17