Mutagenetix > Incidental Mutations

Incidental Mutation 'R7537:Sorl1'

583664

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene?

Possibly non essential (E-score: 0.471) question?

Stock #

R7537 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 41980688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1889 (V1889I)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably benign
Transcript: ENSMUST00000060989
AA Change: V1889I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: V1889I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,173,988	L2229P	possibly damaging	Het
Acaca	T	A	11: 84,260,634	M786K	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adap1	T	G	5: 139,293,173	E117D	possibly damaging	Het
Ap5z1	T	C	5: 142,477,298	S746P	probably benign	Het
Appl2	A	G	10: 83,617,428	I208T	possibly damaging	Het
Astn1	G	A	1: 158,667,638		probably null	Het
Astn1	A	G	1: 158,505,386	E346G	possibly damaging	Het
Atp23	T	A	10: 126,868,725	I180L	unknown	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Cdh23	A	T	10: 60,384,945	I1340N	probably benign	Het
Cdh8	G	A	8: 99,098,885	Q493*	probably null	Het
Ces1g	T	C	8: 93,319,827	I357V	probably benign	Het
Ddx46	A	G	13: 55,650,478	D226G	probably damaging	Het
Eea1	C	T	10: 95,994,905	Q143*	probably null	Het
Erlin2	G	T	8: 27,031,772		probably null	Het
Fat3	T	A	9: 15,938,319	D3929V	probably damaging	Het
Flt3	T	C	5: 147,334,437	D898G	probably damaging	Het
Gm16519	A	G	17: 70,929,356	N100S	probably benign	Het
Gnl1	A	G	17: 35,988,536	H533R	probably damaging	Het
Gphn	A	G	12: 78,504,680	T301A	possibly damaging	Het
Herc2	C	T	7: 56,219,779	R4295*	probably null	Het
Insm2	T	C	12: 55,599,518	S16P	possibly damaging	Het
Jak2	C	T	19: 29,298,637	T778I	probably benign	Het
Lrriq3	A	G	3: 155,101,097	T128A	probably damaging	Het
Lst1	A	G	17: 35,186,944		probably null	Het
Magi1	G	T	6: 93,708,110	Y762*	probably null	Het
Man2b1	T	A	8: 85,090,965	C358*	probably null	Het
Mga	T	C	2: 119,935,551	V1432A	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Morc2a	C	T	11: 3,683,566	Q587*	probably null	Het
Mrc2	T	C	11: 105,292,797	I4T	probably benign	Het
Muc16	C	A	9: 18,638,135	V5621F	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myo3b	A	G	2: 70,217,169	R340G	probably benign	Het
Nipal3	T	C	4: 135,490,937	Y34C	probably damaging	Het
Nktr	T	A	9: 121,749,279	D804E	unknown	Het
Nlrp4b	A	G	7: 10,714,889	M340V	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr385	T	A	11: 73,589,268	T157S	probably benign	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr701	G	A	7: 106,818,374	C97Y	probably damaging	Het
Pard3	T	A	8: 127,610,582	N1271K	probably damaging	Het
Pcdhb11	A	T	18: 37,421,619	M1L	possibly damaging	Het
Pclo	T	C	5: 14,682,104	V3540A	unknown	Het
Pemt	A	G	11: 59,976,844	F154S	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rnpc3	G	T	3: 113,613,832	T376K	probably benign	Het
Rpe65	A	G	3: 159,604,609	Y143C	probably damaging	Het
Sbk2	T	C	7: 4,963,149	E12G	probably benign	Het
Slc2a5	T	C	4: 150,129,069	I106T	possibly damaging	Het
Snx13	A	G	12: 35,085,982	D92G	probably damaging	Het
Spag17	A	T	3: 99,939,247	N29I	possibly damaging	Het
Speg	T	C	1: 75,401,464	V878A	probably damaging	Het
Timp4	A	G	6: 115,250,460	S53P	probably damaging	Het
Tssk1	G	T	16: 17,895,084	E244D	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Vmn2r85	A	T	10: 130,422,866	V440E	probably benign	Het
Wdr59	T	C	8: 111,490,369	D270G		Het
Zbbx	G	A	3: 75,085,519	P223S	probably damaging	Het
Zfp936	T	A	7: 43,189,815	C235*	probably null	Het
Zranb3	A	T	1: 128,032,847		probably null	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACTTAGGAAACTGGCTGTGG -3'
(R):5'- TCAGCATTCTAAAGGCAGAGGG -3'

Sequencing Primer
(F):5'- ACTGGCTGTGGGAACTTACAC -3'
(R):5'- TCTAAAGGCAGAGGGAGTATTTCTC -3'

Posted On

2019-10-17