Mutagenetix > Incidental Mutation

Incidental Mutation 'R7537:Sorl1'

583664

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

045609-MU

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Probably non essential (E-score: 0.244) question?

Stock #

R7537 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 41980688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1889 (V1889I)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably benign
Transcript: ENSMUST00000060989
AA Change: V1889I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: V1889I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,173,988 (GRCm38)	L2229P	possibly damaging	Het
Acaca	T	A	11: 84,260,634 (GRCm38)	M786K	probably damaging	Het
Acta2	G	A	19: 34,252,531 (GRCm38)	T8I	probably benign	Het
Adap1	T	G	5: 139,293,173 (GRCm38)	E117D	possibly damaging	Het
Ap5z1	T	C	5: 142,477,298 (GRCm38)	S746P	probably benign	Het
Appl2	A	G	10: 83,617,428 (GRCm38)	I208T	possibly damaging	Het
Astn1	G	A	1: 158,667,638 (GRCm38)		probably null	Het
Astn1	A	G	1: 158,505,386 (GRCm38)	E346G	possibly damaging	Het
Atp23	T	A	10: 126,868,725 (GRCm38)	I180L	unknown	Het
Bean1	CT	C	8: 104,182,032 (GRCm38)		probably null	Het
Cdh23	A	T	10: 60,384,945 (GRCm38)	I1340N	probably benign	Het
Cdh8	G	A	8: 99,098,885 (GRCm38)	Q493*	probably null	Het
Ces1g	T	C	8: 93,319,827 (GRCm38)	I357V	probably benign	Het
Ddx46	A	G	13: 55,650,478 (GRCm38)	D226G	probably damaging	Het
Eea1	C	T	10: 95,994,905 (GRCm38)	Q143*	probably null	Het
Erlin2	G	T	8: 27,031,772 (GRCm38)		probably null	Het
Fat3	T	A	9: 15,938,319 (GRCm38)	D3929V	probably damaging	Het
Flt3	T	C	5: 147,334,437 (GRCm38)	D898G	probably damaging	Het
Gm16519	A	G	17: 70,929,356 (GRCm38)	N100S	probably benign	Het
Gnl1	A	G	17: 35,988,536 (GRCm38)	H533R	probably damaging	Het
Gphn	A	G	12: 78,504,680 (GRCm38)	T301A	possibly damaging	Het
Herc2	C	T	7: 56,219,779 (GRCm38)	R4295*	probably null	Het
Insm2	T	C	12: 55,599,518 (GRCm38)	S16P	possibly damaging	Het
Jak2	C	T	19: 29,298,637 (GRCm38)	T778I	probably benign	Het
Lrriq3	A	G	3: 155,101,097 (GRCm38)	T128A	probably damaging	Het
Lst1	A	G	17: 35,186,944 (GRCm38)		probably null	Het
Magi1	G	T	6: 93,708,110 (GRCm38)	Y762*	probably null	Het
Man2b1	T	A	8: 85,090,965 (GRCm38)	C358*	probably null	Het
Mga	T	C	2: 119,935,551 (GRCm38)	V1432A	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083 (GRCm38)		probably null	Het
Morc2a	C	T	11: 3,683,566 (GRCm38)	Q587*	probably null	Het
Mrc2	T	C	11: 105,292,797 (GRCm38)	I4T	probably benign	Het
Muc16	C	A	9: 18,638,135 (GRCm38)	V5621F	probably benign	Het
Myl10	G	C	5: 136,697,971 (GRCm38)	V70L	probably benign	Het
Myo3b	A	G	2: 70,217,169 (GRCm38)	R340G	probably benign	Het
Nipal3	T	C	4: 135,490,937 (GRCm38)	Y34C	probably damaging	Het
Nktr	T	A	9: 121,749,279 (GRCm38)	D804E	unknown	Het
Nlrp4b	A	G	7: 10,714,889 (GRCm38)	M340V	probably benign	Het
Olfr1039	A	G	2: 86,131,264 (GRCm38)	V133A	probably benign	Het
Olfr385	T	A	11: 73,589,268 (GRCm38)	T157S	probably benign	Het
Olfr680-ps1	A	T	7: 105,092,771 (GRCm38)	M16K	probably benign	Het
Olfr701	G	A	7: 106,818,374 (GRCm38)	C97Y	probably damaging	Het
Pard3	T	A	8: 127,610,582 (GRCm38)	N1271K	probably damaging	Het
Pcdhb11	A	T	18: 37,421,619 (GRCm38)	M1L	possibly damaging	Het
Pclo	T	C	5: 14,682,104 (GRCm38)	V3540A	unknown	Het
Pemt	A	G	11: 59,976,844 (GRCm38)	F154S	probably damaging	Het
Ptpn18	G	A	1: 34,473,364 (GRCm38)	D417N	possibly damaging	Het
Rnpc3	G	T	3: 113,613,832 (GRCm38)	T376K	probably benign	Het
Rpe65	A	G	3: 159,604,609 (GRCm38)	Y143C	probably damaging	Het
Sbk2	T	C	7: 4,963,149 (GRCm38)	E12G	probably benign	Het
Slc2a5	T	C	4: 150,129,069 (GRCm38)	I106T	possibly damaging	Het
Snx13	A	G	12: 35,085,982 (GRCm38)	D92G	probably damaging	Het
Spag17	A	T	3: 99,939,247 (GRCm38)	N29I	possibly damaging	Het
Speg	T	C	1: 75,401,464 (GRCm38)	V878A	probably damaging	Het
Timp4	A	G	6: 115,250,460 (GRCm38)	S53P	probably damaging	Het
Tssk1	G	T	16: 17,895,084 (GRCm38)	E244D	probably benign	Het
Usp29	A	C	7: 6,961,220 (GRCm38)	T21P	possibly damaging	Het
Vmn2r85	A	T	10: 130,422,866 (GRCm38)	V440E	probably benign	Het
Wdr59	T	C	8: 111,490,369 (GRCm38)	D270G		Het
Zbbx	G	A	3: 75,085,519 (GRCm38)	P223S	probably damaging	Het
Zfp936	T	A	7: 43,189,815 (GRCm38)	C235*	probably null	Het
Zranb3	A	T	1: 128,032,847 (GRCm38)		probably null	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41,974,094 (GRCm38)	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42,024,478 (GRCm38)	splice site	probably benign
IGL01545:Sorl1	APN	9	42,043,956 (GRCm38)	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42,057,269 (GRCm38)	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42,001,492 (GRCm38)	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41,980,711 (GRCm38)	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42,004,034 (GRCm38)	missense	probably benign
IGL02215:Sorl1	APN	9	42,018,182 (GRCm38)	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42,041,690 (GRCm38)	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42,046,561 (GRCm38)	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42,063,774 (GRCm38)	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42,037,059 (GRCm38)	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42,041,053 (GRCm38)	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42,057,325 (GRCm38)	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41,991,426 (GRCm38)	missense	probably benign
IGL03288:Sorl1	APN	9	42,033,562 (GRCm38)	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42,041,596 (GRCm38)	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41,968,622 (GRCm38)	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42,033,577 (GRCm38)	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42,067,933 (GRCm38)	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42,081,954 (GRCm38)	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42,031,909 (GRCm38)	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42,004,088 (GRCm38)	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41,991,371 (GRCm38)	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42,067,832 (GRCm38)	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41,984,506 (GRCm38)	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42,043,900 (GRCm38)	splice site	probably benign
R0831:Sorl1	UTSW	9	42,071,069 (GRCm38)	splice site	probably benign
R0924:Sorl1	UTSW	9	42,008,174 (GRCm38)	splice site	probably benign
R1013:Sorl1	UTSW	9	42,002,559 (GRCm38)	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41,991,456 (GRCm38)	missense	probably benign
R1077:Sorl1	UTSW	9	42,014,490 (GRCm38)	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42,031,796 (GRCm38)	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42,000,412 (GRCm38)	splice site	probably null
R1498:Sorl1	UTSW	9	42,041,073 (GRCm38)	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41,974,000 (GRCm38)	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41,996,242 (GRCm38)	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42,089,965 (GRCm38)	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41,991,482 (GRCm38)	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41,969,725 (GRCm38)	nonsense	probably null
R1912:Sorl1	UTSW	9	42,081,950 (GRCm38)	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42,046,624 (GRCm38)	missense	probably benign
R2071:Sorl1	UTSW	9	41,979,457 (GRCm38)	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41,984,492 (GRCm38)	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41,980,711 (GRCm38)	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42,037,070 (GRCm38)	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41,969,781 (GRCm38)	missense	probably benign
R3815:Sorl1	UTSW	9	42,064,049 (GRCm38)	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42,064,049 (GRCm38)	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42,064,049 (GRCm38)	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42,064,049 (GRCm38)	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42,004,105 (GRCm38)	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41,989,468 (GRCm38)	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42,035,448 (GRCm38)	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42,003,992 (GRCm38)	nonsense	probably null
R4610:Sorl1	UTSW	9	42,031,914 (GRCm38)	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42,004,051 (GRCm38)	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42,004,051 (GRCm38)	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41,984,508 (GRCm38)	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41,992,321 (GRCm38)	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42,063,752 (GRCm38)	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42,041,639 (GRCm38)	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42,014,450 (GRCm38)	splice site	probably null
R4976:Sorl1	UTSW	9	41,983,003 (GRCm38)	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41,991,342 (GRCm38)	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41,996,294 (GRCm38)	missense	probably benign
R5070:Sorl1	UTSW	9	42,031,818 (GRCm38)	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41,976,377 (GRCm38)	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42,033,583 (GRCm38)	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42,106,516 (GRCm38)	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42,030,902 (GRCm38)	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41,979,390 (GRCm38)	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42,057,284 (GRCm38)	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42,057,284 (GRCm38)	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42,002,636 (GRCm38)	nonsense	probably null
R5518:Sorl1	UTSW	9	42,037,212 (GRCm38)	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41,991,625 (GRCm38)	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42,092,373 (GRCm38)	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41,983,034 (GRCm38)	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41,969,742 (GRCm38)	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41,976,407 (GRCm38)	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42,071,234 (GRCm38)	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42,002,567 (GRCm38)	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42,001,603 (GRCm38)	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41,980,645 (GRCm38)	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42,002,567 (GRCm38)	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42,071,201 (GRCm38)	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42,071,201 (GRCm38)	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42,092,452 (GRCm38)	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42,099,263 (GRCm38)	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42,024,398 (GRCm38)	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42,022,392 (GRCm38)	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42,033,626 (GRCm38)	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41,969,751 (GRCm38)	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42,030,983 (GRCm38)	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42,002,634 (GRCm38)	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42,124,079 (GRCm38)	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42,037,203 (GRCm38)	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42,063,710 (GRCm38)	splice site	probably null
R7615:Sorl1	UTSW	9	41,977,582 (GRCm38)	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42,092,334 (GRCm38)	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41,984,526 (GRCm38)	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42,043,909 (GRCm38)	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42,089,961 (GRCm38)	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41,989,359 (GRCm38)	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41,991,401 (GRCm38)	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41,977,561 (GRCm38)	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41,977,561 (GRCm38)	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42,067,933 (GRCm38)	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42,041,561 (GRCm38)	splice site	probably null
R8261:Sorl1	UTSW	9	42,014,481 (GRCm38)	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42,030,998 (GRCm38)	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42,018,160 (GRCm38)	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41,991,745 (GRCm38)	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41,991,745 (GRCm38)	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41,974,074 (GRCm38)	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42,022,426 (GRCm38)	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42,000,271 (GRCm38)	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42,046,552 (GRCm38)	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42,071,195 (GRCm38)	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42,063,754 (GRCm38)	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41,974,124 (GRCm38)	nonsense	probably null
R9278:Sorl1	UTSW	9	42,046,561 (GRCm38)	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42,041,631 (GRCm38)	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41,989,443 (GRCm38)	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42,067,933 (GRCm38)	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42,001,518 (GRCm38)	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42,124,088 (GRCm38)	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42,022,335 (GRCm38)	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42,081,809 (GRCm38)	nonsense	probably null
R9563:Sorl1	UTSW	9	42,046,597 (GRCm38)	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42,046,597 (GRCm38)	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42,081,809 (GRCm38)	nonsense	probably null
R9634:Sorl1	UTSW	9	41,996,294 (GRCm38)	missense	probably benign
R9671:Sorl1	UTSW	9	42,031,781 (GRCm38)	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42,092,470 (GRCm38)	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42,123,948 (GRCm38)	missense	probably benign	0.03
Z1176:Sorl1	UTSW	9	42,099,203 (GRCm38)	missense	possibly damaging	0.64
Z1177:Sorl1	UTSW	9	42,106,541 (GRCm38)	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	41,991,638 (GRCm38)	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42,123,912 (GRCm38)	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42,041,596 (GRCm38)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACTTAGGAAACTGGCTGTGG -3'
(R):5'- TCAGCATTCTAAAGGCAGAGGG -3'

Sequencing Primer
(F):5'- ACTGGCTGTGGGAACTTACAC -3'
(R):5'- TCTAAAGGCAGAGGGAGTATTTCTC -3'

Posted On

2019-10-17