Mutagenetix > Incidental Mutation

Incidental Mutation 'R7537:Appl2'

583667

Institutional Source

Beutler Lab

Gene Symbol

Appl2

Ensembl Gene

ENSMUSG00000020263

Gene Name

adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2

Synonyms

Dip3b

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7537 (G1)

Quality Score

148.008

Status

Validated

Chromosome

Chromosomal Location

83600033-83648738 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83617428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 208 (I208T)

Ref Sequence

ENSEMBL: ENSMUSP00000020500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020500] [ENSMUST00000146876] [ENSMUST00000150685]

AlphaFold

Q8K3G9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020500
AA Change: I208T

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000020500
Gene: ENSMUSG00000020263
AA Change: I208T

Domain	Start	End	E-Value	Type
Pfam:BAR_3	7	248	6.4e-69	PFAM
PH	278	377	1.2e-7	SMART
Pfam:PTB	491	613	6e-7	PFAM
Pfam:PID	492	611	1.6e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146876
AA Change: I207T

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000121336
Gene: ENSMUSG00000020263
AA Change: I207T

Domain	Start	End	E-Value	Type
PDB:4H8S\|D	2	209	1e-141	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000150685

SMART Domains

Protein: ENSMUSP00000115903
Gene: ENSMUSG00000020263

Domain	Start	End	E-Value	Type
PDB:4H8S\|D	2	95	4e-59	PDB

Meta Mutation Damage Score

0.5985

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two effectors of the small GTPase RAB5A/Rab5, which are involved in a signal transduction pathway. Both effectors contain an N-terminal Bin/Amphiphysin/Rvs (BAR) domain, a central pleckstrin homology (PH) domain, and a C-terminal phosphotyrosine binding (PTB) domain, and they bind the Rab5 through the BAR domain. They are associated with endosomal membranes and can be translocated to the nucleus in response to the EGF stimulus. They interact with the NuRD/MeCP1 complex (nucleosome remodeling and deacetylase /methyl-CpG-binding protein 1 complex) and are required for efficient cell proliferation. A chromosomal aberration t(12;22)(q24.1;q13.3) involving this gene and the PSAP2 gene results in 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele display altered red blood cell physiology. Mutant MEFs exhibit defects in HGF-induced Akt activation, migration, and invasion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,173,988	L2229P	possibly damaging	Het
Acaca	T	A	11: 84,260,634	M786K	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adap1	T	G	5: 139,293,173	E117D	possibly damaging	Het
Ap5z1	T	C	5: 142,477,298	S746P	probably benign	Het
Astn1	A	G	1: 158,505,386	E346G	possibly damaging	Het
Astn1	G	A	1: 158,667,638		probably null	Het
Atp23	T	A	10: 126,868,725	I180L	unknown	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Cdh23	A	T	10: 60,384,945	I1340N	probably benign	Het
Cdh8	G	A	8: 99,098,885	Q493*	probably null	Het
Ces1g	T	C	8: 93,319,827	I357V	probably benign	Het
Ddx46	A	G	13: 55,650,478	D226G	probably damaging	Het
Eea1	C	T	10: 95,994,905	Q143*	probably null	Het
Erlin2	G	T	8: 27,031,772		probably null	Het
Fat3	T	A	9: 15,938,319	D3929V	probably damaging	Het
Flt3	T	C	5: 147,334,437	D898G	probably damaging	Het
Gm16519	A	G	17: 70,929,356	N100S	probably benign	Het
Gnl1	A	G	17: 35,988,536	H533R	probably damaging	Het
Gphn	A	G	12: 78,504,680	T301A	possibly damaging	Het
Herc2	C	T	7: 56,219,779	R4295*	probably null	Het
Insm2	T	C	12: 55,599,518	S16P	possibly damaging	Het
Jak2	C	T	19: 29,298,637	T778I	probably benign	Het
Lrriq3	A	G	3: 155,101,097	T128A	probably damaging	Het
Lst1	A	G	17: 35,186,944		probably null	Het
Magi1	G	T	6: 93,708,110	Y762*	probably null	Het
Man2b1	T	A	8: 85,090,965	C358*	probably null	Het
Mga	T	C	2: 119,935,551	V1432A	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Morc2a	C	T	11: 3,683,566	Q587*	probably null	Het
Mrc2	T	C	11: 105,292,797	I4T	probably benign	Het
Muc16	C	A	9: 18,638,135	V5621F	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myo3b	A	G	2: 70,217,169	R340G	probably benign	Het
Nipal3	T	C	4: 135,490,937	Y34C	probably damaging	Het
Nktr	T	A	9: 121,749,279	D804E	unknown	Het
Nlrp4b	A	G	7: 10,714,889	M340V	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr385	T	A	11: 73,589,268	T157S	probably benign	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr701	G	A	7: 106,818,374	C97Y	probably damaging	Het
Pard3	T	A	8: 127,610,582	N1271K	probably damaging	Het
Pcdhb11	A	T	18: 37,421,619	M1L	possibly damaging	Het
Pclo	T	C	5: 14,682,104	V3540A	unknown	Het
Pemt	A	G	11: 59,976,844	F154S	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rnpc3	G	T	3: 113,613,832	T376K	probably benign	Het
Rpe65	A	G	3: 159,604,609	Y143C	probably damaging	Het
Sbk2	T	C	7: 4,963,149	E12G	probably benign	Het
Slc2a5	T	C	4: 150,129,069	I106T	possibly damaging	Het
Snx13	A	G	12: 35,085,982	D92G	probably damaging	Het
Sorl1	C	T	9: 41,980,688	V1889I	probably benign	Het
Spag17	A	T	3: 99,939,247	N29I	possibly damaging	Het
Speg	T	C	1: 75,401,464	V878A	probably damaging	Het
Timp4	A	G	6: 115,250,460	S53P	probably damaging	Het
Tssk1	G	T	16: 17,895,084	E244D	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Vmn2r85	A	T	10: 130,422,866	V440E	probably benign	Het
Wdr59	T	C	8: 111,490,369	D270G		Het
Zbbx	G	A	3: 75,085,519	P223S	probably damaging	Het
Zfp936	T	A	7: 43,189,815	C235*	probably null	Het
Zranb3	A	T	1: 128,032,847		probably null	Het

Other mutations in Appl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01681:Appl2	APN	10	83614301	missense	possibly damaging	0.95
IGL01794:Appl2	APN	10	83614294	missense	probably benign
IGL01887:Appl2	APN	10	83621522	unclassified	probably benign
IGL03071:Appl2	APN	10	83641106	critical splice acceptor site	probably null
IGL03077:Appl2	APN	10	83621759	unclassified	probably benign
R0006:Appl2	UTSW	10	83602898	missense	probably damaging	1.00
R0006:Appl2	UTSW	10	83602898	missense	probably damaging	1.00
R0591:Appl2	UTSW	10	83624645	missense	possibly damaging	0.94
R1695:Appl2	UTSW	10	83621582	missense	probably damaging	0.99
R2217:Appl2	UTSW	10	83608737	missense	possibly damaging	0.47
R2218:Appl2	UTSW	10	83608737	missense	possibly damaging	0.47
R4782:Appl2	UTSW	10	83600991	missense	probably damaging	1.00
R4889:Appl2	UTSW	10	83641058	missense	probably damaging	1.00
R5109:Appl2	UTSW	10	83601007	missense	probably benign	0.06
R5460:Appl2	UTSW	10	83602832	missense	probably benign	0.00
R5512:Appl2	UTSW	10	83605818	missense	probably damaging	1.00
R6023:Appl2	UTSW	10	83648529	missense	probably null	0.00
R6047:Appl2	UTSW	10	83612901	critical splice acceptor site	probably null
R7403:Appl2	UTSW	10	83614195	missense	probably benign	0.00
R8488:Appl2	UTSW	10	83611002	missense	probably benign	0.02
R9203:Appl2	UTSW	10	83641015	nonsense	probably null
X0027:Appl2	UTSW	10	83621554	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGTTTTCATGTTGGGAGAGCC -3'
(R):5'- ACTTGGGCCTTCTCAACCAG -3'

Sequencing Primer
(F):5'- GCTCTGTTGACCTCTGAAGACAG -3'
(R):5'- GGCCTTCTCAACCAGTGTGC -3'

Posted On

2019-10-17