Incidental Mutation 'R7537:Atp23'
ID 583669
Institutional Source Beutler Lab
Gene Symbol Atp23
Ensembl Gene ENSMUSG00000025436
Gene Name ATP23 metallopeptidase and ATP synthase assembly factor homolog
Synonyms Xrcc6bp1, 2410012H02Rik, 1110068E08Rik
MMRRC Submission 045609-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R7537 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 126704296-126737224 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126704594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 180 (I180L)
Ref Sequence ENSEMBL: ENSMUSP00000026504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026504]
AlphaFold Q9CWQ3
Predicted Effect unknown
Transcript: ENSMUST00000026504
AA Change: I180L
SMART Domains Protein: ENSMUSP00000026504
Gene: ENSMUSG00000025436
AA Change: I180L

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:Peptidase_M76 49 197 1.3e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is amplified in glioblastomas and interacts with the DNA binding subunit of DNA-dependent protein kinase. This kinase is involved in double-strand break repair (DSB), and higher expression of the encoded protein increases the efficiency of DSB. In addition, comparison to orthologous proteins strongly suggests that this protein is a metalloprotease important in the biosynthesis of mitochondrial ATPase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 121,967,637 (GRCm39) L2229P possibly damaging Het
Acaca T A 11: 84,151,460 (GRCm39) M786K probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adap1 T G 5: 139,278,928 (GRCm39) E117D possibly damaging Het
Ap5z1 T C 5: 142,463,053 (GRCm39) S746P probably benign Het
Appl2 A G 10: 83,453,292 (GRCm39) I208T possibly damaging Het
Astn1 A G 1: 158,332,956 (GRCm39) E346G possibly damaging Het
Astn1 G A 1: 158,495,208 (GRCm39) probably null Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cdh23 A T 10: 60,220,724 (GRCm39) I1340N probably benign Het
Cdh8 G A 8: 99,825,517 (GRCm39) Q493* probably null Het
Ces1g T C 8: 94,046,455 (GRCm39) I357V probably benign Het
Ddx46 A G 13: 55,798,291 (GRCm39) D226G probably damaging Het
Eea1 C T 10: 95,830,767 (GRCm39) Q143* probably null Het
Erlin2 G T 8: 27,521,800 (GRCm39) probably null Het
Fat3 T A 9: 15,849,615 (GRCm39) D3929V probably damaging Het
Flt3 T C 5: 147,271,247 (GRCm39) D898G probably damaging Het
Gm16519 A G 17: 71,236,351 (GRCm39) N100S probably benign Het
Gnl1 A G 17: 36,299,428 (GRCm39) H533R probably damaging Het
Gphn A G 12: 78,551,454 (GRCm39) T301A possibly damaging Het
Herc2 C T 7: 55,869,527 (GRCm39) R4295* probably null Het
Insm2 T C 12: 55,646,303 (GRCm39) S16P possibly damaging Het
Jak2 C T 19: 29,276,037 (GRCm39) T778I probably benign Het
Lrriq3 A G 3: 154,806,734 (GRCm39) T128A probably damaging Het
Lst1 A G 17: 35,405,920 (GRCm39) probably null Het
Magi1 G T 6: 93,685,091 (GRCm39) Y762* probably null Het
Man2b1 T A 8: 85,817,594 (GRCm39) C358* probably null Het
Mga T C 2: 119,766,032 (GRCm39) V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Morc2a C T 11: 3,633,566 (GRCm39) Q587* probably null Het
Mrc2 T C 11: 105,183,623 (GRCm39) I4T probably benign Het
Muc16 C A 9: 18,549,431 (GRCm39) V5621F probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myo3b A G 2: 70,047,513 (GRCm39) R340G probably benign Het
Nipal3 T C 4: 135,218,248 (GRCm39) Y34C probably damaging Het
Nktr T A 9: 121,578,345 (GRCm39) D804E unknown Het
Nlrp4b A G 7: 10,448,816 (GRCm39) M340V probably benign Het
Or1e26 T A 11: 73,480,094 (GRCm39) T157S probably benign Het
Or2ag2b G A 7: 106,417,581 (GRCm39) C97Y probably damaging Het
Or56a41 A T 7: 104,741,978 (GRCm39) M16K probably benign Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Pard3 T A 8: 128,337,063 (GRCm39) N1271K probably damaging Het
Pcdhb11 A T 18: 37,554,672 (GRCm39) M1L possibly damaging Het
Pclo T C 5: 14,732,118 (GRCm39) V3540A unknown Het
Pemt A G 11: 59,867,670 (GRCm39) F154S probably damaging Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rnpc3 G T 3: 113,407,481 (GRCm39) T376K probably benign Het
Rpe65 A G 3: 159,310,246 (GRCm39) Y143C probably damaging Het
Sbk2 T C 7: 4,966,148 (GRCm39) E12G probably benign Het
Slc2a5 T C 4: 150,213,526 (GRCm39) I106T possibly damaging Het
Snx13 A G 12: 35,135,981 (GRCm39) D92G probably damaging Het
Sorl1 C T 9: 41,891,984 (GRCm39) V1889I probably benign Het
Spag17 A T 3: 99,846,563 (GRCm39) N29I possibly damaging Het
Speg T C 1: 75,378,108 (GRCm39) V878A probably damaging Het
Timp4 A G 6: 115,227,421 (GRCm39) S53P probably damaging Het
Tssk1 G T 16: 17,712,948 (GRCm39) E244D probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Vmn2r85 A T 10: 130,258,735 (GRCm39) V440E probably benign Het
Wdr59 T C 8: 112,217,001 (GRCm39) D270G Het
Zbbx G A 3: 74,992,826 (GRCm39) P223S probably damaging Het
Zfp936 T A 7: 42,839,239 (GRCm39) C235* probably null Het
Zranb3 A T 1: 127,960,584 (GRCm39) probably null Het
Other mutations in Atp23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Atp23 APN 10 126,736,969 (GRCm39) critical splice donor site probably null
IGL01832:Atp23 APN 10 126,730,214 (GRCm39) missense probably damaging 1.00
IGL03097:Atp23 UTSW 10 126,723,556 (GRCm39) missense probably damaging 1.00
R2099:Atp23 UTSW 10 126,727,595 (GRCm39) splice site probably null
R5114:Atp23 UTSW 10 126,723,403 (GRCm39) missense possibly damaging 0.92
R5505:Atp23 UTSW 10 126,723,499 (GRCm39) missense probably damaging 0.99
R5652:Atp23 UTSW 10 126,735,494 (GRCm39) missense possibly damaging 0.92
R5778:Atp23 UTSW 10 126,735,451 (GRCm39) missense probably damaging 1.00
R6230:Atp23 UTSW 10 126,723,431 (GRCm39) missense probably benign 0.13
R6334:Atp23 UTSW 10 126,723,538 (GRCm39) missense probably benign 0.00
R8253:Atp23 UTSW 10 126,704,543 (GRCm39) missense probably benign 0.43
R8351:Atp23 UTSW 10 126,723,407 (GRCm39) missense probably damaging 1.00
R8927:Atp23 UTSW 10 126,723,362 (GRCm39) makesense probably null
R8928:Atp23 UTSW 10 126,723,362 (GRCm39) makesense probably null
R9773:Atp23 UTSW 10 126,734,763 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAAATATAGTCAGACACCAAAGTCA -3'
(R):5'- AGAGTGGTGAGAGTCGAGTT -3'

Sequencing Primer
(F):5'- TCATAACAGTCAGACCATGATGG -3'
(R):5'- CTGCAATGATCCCTGAAGCTTAGG -3'
Posted On 2019-10-17