Incidental Mutation 'R7537:Vmn2r85'
ID583670
Institutional Source Beutler Lab
Gene Symbol Vmn2r85
Ensembl Gene ENSMUSG00000092048
Gene Namevomeronasal 2, receptor 85
SynonymsEG623734
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location130417772-130429612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130422866 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 440 (V440E)
Ref Sequence ENSEMBL: ENSMUSP00000128792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171811]
Predicted Effect probably benign
Transcript: ENSMUST00000171811
AA Change: V440E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128792
Gene: ENSMUSG00000092048
AA Change: V440E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 9e-26 PFAM
Pfam:NCD3G 508 562 1.1e-18 PFAM
Pfam:7tm_3 595 831 3.7e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Vmn2r85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL01298:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL01361:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL02185:Vmn2r85 APN 10 130418692 missense probably benign 0.13
IGL02505:Vmn2r85 APN 10 130425580 missense probably damaging 1.00
IGL02607:Vmn2r85 APN 10 130426421 missense possibly damaging 0.89
IGL02755:Vmn2r85 APN 10 130425512 missense probably damaging 0.98
IGL03188:Vmn2r85 APN 10 130418743 missense probably benign 0.16
IGL03366:Vmn2r85 APN 10 130426459 missense probably benign 0.00
IGL03397:Vmn2r85 APN 10 130425394 missense probably damaging 1.00
PIT4445001:Vmn2r85 UTSW 10 130425703 missense probably benign 0.00
R0066:Vmn2r85 UTSW 10 130425901 missense probably damaging 1.00
R0128:Vmn2r85 UTSW 10 130419185 splice site probably benign
R0130:Vmn2r85 UTSW 10 130419185 splice site probably benign
R0503:Vmn2r85 UTSW 10 130422740 missense probably damaging 1.00
R0827:Vmn2r85 UTSW 10 130429518 missense possibly damaging 0.89
R1432:Vmn2r85 UTSW 10 130425286 missense possibly damaging 0.74
R1521:Vmn2r85 UTSW 10 130425919 missense probably damaging 0.99
R2029:Vmn2r85 UTSW 10 130425574 nonsense probably null
R2034:Vmn2r85 UTSW 10 130426373 splice site probably benign
R2852:Vmn2r85 UTSW 10 130419166 missense probably benign 0.03
R2853:Vmn2r85 UTSW 10 130419166 missense probably benign 0.03
R3084:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R3085:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R3430:Vmn2r85 UTSW 10 130418889 missense probably damaging 0.97
R3694:Vmn2r85 UTSW 10 130418302 missense probably damaging 0.99
R3932:Vmn2r85 UTSW 10 130418467 missense probably damaging 1.00
R4207:Vmn2r85 UTSW 10 130418705 missense probably damaging 1.00
R4628:Vmn2r85 UTSW 10 130425366 missense probably benign 0.00
R4814:Vmn2r85 UTSW 10 130418698 missense probably benign 0.12
R4948:Vmn2r85 UTSW 10 130419121 missense probably damaging 1.00
R4951:Vmn2r85 UTSW 10 130425244 missense probably damaging 1.00
R4959:Vmn2r85 UTSW 10 130421433 missense probably damaging 1.00
R5336:Vmn2r85 UTSW 10 130422705 missense possibly damaging 0.63
R5643:Vmn2r85 UTSW 10 130426474 missense probably damaging 1.00
R6061:Vmn2r85 UTSW 10 130425662 missense probably benign 0.09
R6115:Vmn2r85 UTSW 10 130422803 missense probably damaging 1.00
R6190:Vmn2r85 UTSW 10 130425461 missense possibly damaging 0.88
R6518:Vmn2r85 UTSW 10 130429412 missense probably benign 0.00
R6533:Vmn2r85 UTSW 10 130426660 missense probably benign 0.00
R6610:Vmn2r85 UTSW 10 130425969 missense probably damaging 0.97
R6809:Vmn2r85 UTSW 10 130425926 missense probably benign
R6962:Vmn2r85 UTSW 10 130425583 missense probably damaging 0.99
R7075:Vmn2r85 UTSW 10 130422688 missense probably benign 0.06
R7104:Vmn2r85 UTSW 10 130426507 missense probably benign
R7424:Vmn2r85 UTSW 10 130418980 missense probably damaging 1.00
R7516:Vmn2r85 UTSW 10 130418983 missense probably damaging 1.00
R7768:Vmn2r85 UTSW 10 130418693 missense probably damaging 1.00
R7810:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R8078:Vmn2r85 UTSW 10 130429495 nonsense probably null
R8115:Vmn2r85 UTSW 10 130425951 missense probably benign 0.06
R8262:Vmn2r85 UTSW 10 130418869 missense probably damaging 0.98
R8395:Vmn2r85 UTSW 10 130425928 missense probably damaging 0.99
R8409:Vmn2r85 UTSW 10 130425388 missense probably benign 0.16
Z1176:Vmn2r85 UTSW 10 130425844 missense probably damaging 0.99
Z1177:Vmn2r85 UTSW 10 130418907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGGCCCATTCCAAATC -3'
(R):5'- CAATTTCCAGACATTCAGACTTCCC -3'

Sequencing Primer
(F):5'- GTGGCCCATTCCAAATCTTCAG -3'
(R):5'- CATACACCATGTTACTTGATATCTGG -3'
Posted On2019-10-17