Incidental Mutation 'R7537:Or1e26'
ID 583673
Institutional Source Beutler Lab
Gene Symbol Or1e26
Ensembl Gene ENSMUSG00000095095
Gene Name olfactory receptor family 1 subfamily E member 26
Synonyms Olfr385, GA_x6K02T2P1NL-3760313-3759375, MOR135-3
MMRRC Submission 045609-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R7537 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 73479624-73480562 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73480094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 157 (T157S)
Ref Sequence ENSEMBL: ENSMUSP00000149293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071553] [ENSMUST00000215689]
AlphaFold Q8VGT1
Predicted Effect probably benign
Transcript: ENSMUST00000071553
AA Change: T157S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071484
Gene: ENSMUSG00000095095
AA Change: T157S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.1e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.7e-6 PFAM
Pfam:7tm_1 41 290 2.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215689
AA Change: T157S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 121,967,637 (GRCm39) L2229P possibly damaging Het
Acaca T A 11: 84,151,460 (GRCm39) M786K probably damaging Het
Acta2 G A 19: 34,229,931 (GRCm39) T8I probably benign Het
Adap1 T G 5: 139,278,928 (GRCm39) E117D possibly damaging Het
Ap5z1 T C 5: 142,463,053 (GRCm39) S746P probably benign Het
Appl2 A G 10: 83,453,292 (GRCm39) I208T possibly damaging Het
Astn1 A G 1: 158,332,956 (GRCm39) E346G possibly damaging Het
Astn1 G A 1: 158,495,208 (GRCm39) probably null Het
Atp23 T A 10: 126,704,594 (GRCm39) I180L unknown Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cdh23 A T 10: 60,220,724 (GRCm39) I1340N probably benign Het
Cdh8 G A 8: 99,825,517 (GRCm39) Q493* probably null Het
Ces1g T C 8: 94,046,455 (GRCm39) I357V probably benign Het
Ddx46 A G 13: 55,798,291 (GRCm39) D226G probably damaging Het
Eea1 C T 10: 95,830,767 (GRCm39) Q143* probably null Het
Erlin2 G T 8: 27,521,800 (GRCm39) probably null Het
Fat3 T A 9: 15,849,615 (GRCm39) D3929V probably damaging Het
Flt3 T C 5: 147,271,247 (GRCm39) D898G probably damaging Het
Gm16519 A G 17: 71,236,351 (GRCm39) N100S probably benign Het
Gnl1 A G 17: 36,299,428 (GRCm39) H533R probably damaging Het
Gphn A G 12: 78,551,454 (GRCm39) T301A possibly damaging Het
Herc2 C T 7: 55,869,527 (GRCm39) R4295* probably null Het
Insm2 T C 12: 55,646,303 (GRCm39) S16P possibly damaging Het
Jak2 C T 19: 29,276,037 (GRCm39) T778I probably benign Het
Lrriq3 A G 3: 154,806,734 (GRCm39) T128A probably damaging Het
Lst1 A G 17: 35,405,920 (GRCm39) probably null Het
Magi1 G T 6: 93,685,091 (GRCm39) Y762* probably null Het
Man2b1 T A 8: 85,817,594 (GRCm39) C358* probably null Het
Mga T C 2: 119,766,032 (GRCm39) V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Morc2a C T 11: 3,633,566 (GRCm39) Q587* probably null Het
Mrc2 T C 11: 105,183,623 (GRCm39) I4T probably benign Het
Muc16 C A 9: 18,549,431 (GRCm39) V5621F probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Myo3b A G 2: 70,047,513 (GRCm39) R340G probably benign Het
Nipal3 T C 4: 135,218,248 (GRCm39) Y34C probably damaging Het
Nktr T A 9: 121,578,345 (GRCm39) D804E unknown Het
Nlrp4b A G 7: 10,448,816 (GRCm39) M340V probably benign Het
Or2ag2b G A 7: 106,417,581 (GRCm39) C97Y probably damaging Het
Or56a41 A T 7: 104,741,978 (GRCm39) M16K probably benign Het
Or5al5 A G 2: 85,961,608 (GRCm39) V133A probably benign Het
Pard3 T A 8: 128,337,063 (GRCm39) N1271K probably damaging Het
Pcdhb11 A T 18: 37,554,672 (GRCm39) M1L possibly damaging Het
Pclo T C 5: 14,732,118 (GRCm39) V3540A unknown Het
Pemt A G 11: 59,867,670 (GRCm39) F154S probably damaging Het
Ptpn18 G A 1: 34,512,445 (GRCm39) D417N possibly damaging Het
Rnpc3 G T 3: 113,407,481 (GRCm39) T376K probably benign Het
Rpe65 A G 3: 159,310,246 (GRCm39) Y143C probably damaging Het
Sbk2 T C 7: 4,966,148 (GRCm39) E12G probably benign Het
Slc2a5 T C 4: 150,213,526 (GRCm39) I106T possibly damaging Het
Snx13 A G 12: 35,135,981 (GRCm39) D92G probably damaging Het
Sorl1 C T 9: 41,891,984 (GRCm39) V1889I probably benign Het
Spag17 A T 3: 99,846,563 (GRCm39) N29I possibly damaging Het
Speg T C 1: 75,378,108 (GRCm39) V878A probably damaging Het
Timp4 A G 6: 115,227,421 (GRCm39) S53P probably damaging Het
Tssk1 G T 16: 17,712,948 (GRCm39) E244D probably benign Het
Usp29 A C 7: 6,964,219 (GRCm39) T21P possibly damaging Het
Vmn2r85 A T 10: 130,258,735 (GRCm39) V440E probably benign Het
Wdr59 T C 8: 112,217,001 (GRCm39) D270G Het
Zbbx G A 3: 74,992,826 (GRCm39) P223S probably damaging Het
Zfp936 T A 7: 42,839,239 (GRCm39) C235* probably null Het
Zranb3 A T 1: 127,960,584 (GRCm39) probably null Het
Other mutations in Or1e26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Or1e26 APN 11 73,480,209 (GRCm39) missense probably benign 0.34
IGL02045:Or1e26 APN 11 73,480,058 (GRCm39) missense probably damaging 1.00
IGL02324:Or1e26 APN 11 73,480,081 (GRCm39) missense probably benign 0.02
IGL02328:Or1e26 APN 11 73,480,081 (GRCm39) missense probably benign 0.02
IGL02562:Or1e26 APN 11 73,480,237 (GRCm39) missense probably benign
IGL02715:Or1e26 APN 11 73,479,947 (GRCm39) missense probably benign 0.00
IGL03182:Or1e26 APN 11 73,480,268 (GRCm39) missense probably benign 0.04
IGL03048:Or1e26 UTSW 11 73,479,831 (GRCm39) missense possibly damaging 0.56
R0346:Or1e26 UTSW 11 73,480,283 (GRCm39) missense probably damaging 1.00
R0675:Or1e26 UTSW 11 73,480,078 (GRCm39) missense probably damaging 1.00
R0751:Or1e26 UTSW 11 73,479,970 (GRCm39) missense probably benign 0.02
R1220:Or1e26 UTSW 11 73,480,203 (GRCm39) nonsense probably null
R1389:Or1e26 UTSW 11 73,480,369 (GRCm39) missense possibly damaging 0.88
R1484:Or1e26 UTSW 11 73,480,187 (GRCm39) missense possibly damaging 0.91
R1619:Or1e26 UTSW 11 73,480,118 (GRCm39) missense probably damaging 1.00
R2290:Or1e26 UTSW 11 73,479,745 (GRCm39) missense probably benign 0.37
R3713:Or1e26 UTSW 11 73,479,731 (GRCm39) missense probably damaging 1.00
R3781:Or1e26 UTSW 11 73,480,194 (GRCm39) nonsense probably null
R3781:Or1e26 UTSW 11 73,479,839 (GRCm39) missense probably damaging 1.00
R3782:Or1e26 UTSW 11 73,480,194 (GRCm39) nonsense probably null
R3782:Or1e26 UTSW 11 73,479,839 (GRCm39) missense probably damaging 1.00
R4402:Or1e26 UTSW 11 73,480,081 (GRCm39) missense probably benign 0.02
R4721:Or1e26 UTSW 11 73,480,273 (GRCm39) missense probably damaging 1.00
R5157:Or1e26 UTSW 11 73,480,549 (GRCm39) missense probably damaging 1.00
R5995:Or1e26 UTSW 11 73,480,076 (GRCm39) missense probably benign
R6373:Or1e26 UTSW 11 73,479,724 (GRCm39) missense probably benign 0.42
R6658:Or1e26 UTSW 11 73,479,874 (GRCm39) missense probably damaging 0.99
R7046:Or1e26 UTSW 11 73,480,558 (GRCm39) missense probably benign
R7096:Or1e26 UTSW 11 73,480,463 (GRCm39) missense probably benign 0.03
R7238:Or1e26 UTSW 11 73,480,561 (GRCm39) start codon destroyed probably null 0.99
R7548:Or1e26 UTSW 11 73,479,802 (GRCm39) missense possibly damaging 0.56
R7888:Or1e26 UTSW 11 73,480,354 (GRCm39) missense probably damaging 0.99
R7968:Or1e26 UTSW 11 73,480,154 (GRCm39) missense probably benign 0.05
R8923:Or1e26 UTSW 11 73,480,076 (GRCm39) missense probably benign
R9006:Or1e26 UTSW 11 73,480,036 (GRCm39) missense probably benign 0.40
R9281:Or1e26 UTSW 11 73,480,133 (GRCm39) missense probably benign
R9689:Or1e26 UTSW 11 73,479,686 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATTCCCCGTGTAGATG -3'
(R):5'- CCAAGTTGCTGCAGAACATG -3'

Sequencing Primer
(F):5'- GGCTATTCCCCGTGTAGATGAAAAC -3'
(R):5'- GACACAACCATCTCCTATGTAGGTTG -3'
Posted On 2019-10-17