Mutagenetix > Incidental Mutation

Incidental Mutation 'R7537:Gnl1'

583681

Institutional Source

Beutler Lab

Gene Symbol

Gnl1

Ensembl Gene

ENSMUSG00000024429

Gene Name

guanine nucleotide binding protein-like 1

Synonyms

Gnal1, Gna-rs1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R7537 (G1)

Quality Score

177.009

Status

Validated

Chromosome

Chromosomal Location

35979851-35989462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35988536 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 533 (H533R)

Ref Sequence

ENSEMBL: ENSMUSP00000084450 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087200]

AlphaFold

P36916

Predicted Effect

probably damaging
Transcript: ENSMUST00000087200
AA Change: H533R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000084450
Gene: ENSMUSG00000024429
AA Change: H533R

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	31	46	N/A	INTRINSIC
low complexity region	90	102	N/A	INTRINSIC
SCOP:d1egaa1	179	232	6e-3	SMART
Pfam:MMR_HSR1	362	465	1.4e-13	PFAM
low complexity region	550	583	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GNL1 gene, identified in the human major histocompatibility complex class I region, shows a high degree of similarity with its mouse counterpart. The GNL1 gene is located less than 2 kb centromeric to HLA-E, in the same transcriptional orientation. GNL1 is telomeric to HLA-B and HLA-C. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,173,988	L2229P	possibly damaging	Het
Acaca	T	A	11: 84,260,634	M786K	probably damaging	Het
Acta2	G	A	19: 34,252,531	T8I	probably benign	Het
Adap1	T	G	5: 139,293,173	E117D	possibly damaging	Het
Ap5z1	T	C	5: 142,477,298	S746P	probably benign	Het
Appl2	A	G	10: 83,617,428	I208T	possibly damaging	Het
Astn1	G	A	1: 158,667,638		probably null	Het
Astn1	A	G	1: 158,505,386	E346G	possibly damaging	Het
Atp23	T	A	10: 126,868,725	I180L	unknown	Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Cdh23	A	T	10: 60,384,945	I1340N	probably benign	Het
Cdh8	G	A	8: 99,098,885	Q493*	probably null	Het
Ces1g	T	C	8: 93,319,827	I357V	probably benign	Het
Ddx46	A	G	13: 55,650,478	D226G	probably damaging	Het
Eea1	C	T	10: 95,994,905	Q143*	probably null	Het
Erlin2	G	T	8: 27,031,772		probably null	Het
Fat3	T	A	9: 15,938,319	D3929V	probably damaging	Het
Flt3	T	C	5: 147,334,437	D898G	probably damaging	Het
Gm16519	A	G	17: 70,929,356	N100S	probably benign	Het
Gphn	A	G	12: 78,504,680	T301A	possibly damaging	Het
Herc2	C	T	7: 56,219,779	R4295*	probably null	Het
Insm2	T	C	12: 55,599,518	S16P	possibly damaging	Het
Jak2	C	T	19: 29,298,637	T778I	probably benign	Het
Lrriq3	A	G	3: 155,101,097	T128A	probably damaging	Het
Lst1	A	G	17: 35,186,944		probably null	Het
Magi1	G	T	6: 93,708,110	Y762*	probably null	Het
Man2b1	T	A	8: 85,090,965	C358*	probably null	Het
Mga	T	C	2: 119,935,551	V1432A	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Morc2a	C	T	11: 3,683,566	Q587*	probably null	Het
Mrc2	T	C	11: 105,292,797	I4T	probably benign	Het
Muc16	C	A	9: 18,638,135	V5621F	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myo3b	A	G	2: 70,217,169	R340G	probably benign	Het
Nipal3	T	C	4: 135,490,937	Y34C	probably damaging	Het
Nktr	T	A	9: 121,749,279	D804E	unknown	Het
Nlrp4b	A	G	7: 10,714,889	M340V	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr385	T	A	11: 73,589,268	T157S	probably benign	Het
Olfr680-ps1	A	T	7: 105,092,771	M16K	probably benign	Het
Olfr701	G	A	7: 106,818,374	C97Y	probably damaging	Het
Pard3	T	A	8: 127,610,582	N1271K	probably damaging	Het
Pcdhb11	A	T	18: 37,421,619	M1L	possibly damaging	Het
Pclo	T	C	5: 14,682,104	V3540A	unknown	Het
Pemt	A	G	11: 59,976,844	F154S	probably damaging	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rnpc3	G	T	3: 113,613,832	T376K	probably benign	Het
Rpe65	A	G	3: 159,604,609	Y143C	probably damaging	Het
Sbk2	T	C	7: 4,963,149	E12G	probably benign	Het
Slc2a5	T	C	4: 150,129,069	I106T	possibly damaging	Het
Snx13	A	G	12: 35,085,982	D92G	probably damaging	Het
Sorl1	C	T	9: 41,980,688	V1889I	probably benign	Het
Spag17	A	T	3: 99,939,247	N29I	possibly damaging	Het
Speg	T	C	1: 75,401,464	V878A	probably damaging	Het
Timp4	A	G	6: 115,250,460	S53P	probably damaging	Het
Tssk1	G	T	16: 17,895,084	E244D	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Vmn2r85	A	T	10: 130,422,866	V440E	probably benign	Het
Wdr59	T	C	8: 111,490,369	D270G		Het
Zbbx	G	A	3: 75,085,519	P223S	probably damaging	Het
Zfp936	T	A	7: 43,189,815	C235*	probably null	Het
Zranb3	A	T	1: 128,032,847		probably null	Het

Other mutations in Gnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02956:Gnl1	APN	17	35987612	missense	probably benign
IGL03325:Gnl1	APN	17	35988656	missense	probably damaging	1.00
lepidoptera	UTSW	17	35987549	missense	probably damaging	1.00
mariposa	UTSW	17	35987533	nonsense	probably null
Morning_cloak	UTSW	17	35983413	missense	probably benign	0.01
papillon	UTSW	17	35987595	nonsense	probably null
R0648:Gnl1	UTSW	17	35982598	missense	probably damaging	1.00
R1611:Gnl1	UTSW	17	35987549	missense	probably damaging	1.00
R1781:Gnl1	UTSW	17	35987746	missense	probably damaging	1.00
R1897:Gnl1	UTSW	17	35988692	missense	possibly damaging	0.73
R2027:Gnl1	UTSW	17	35982958	missense	probably benign
R2240:Gnl1	UTSW	17	35982679	missense	probably benign	0.04
R3944:Gnl1	UTSW	17	35988521	missense	probably benign	0.09
R4569:Gnl1	UTSW	17	35988250	missense	probably benign	0.00
R4849:Gnl1	UTSW	17	35987711	splice site	probably null
R4969:Gnl1	UTSW	17	35980689	missense	possibly damaging	0.62
R5661:Gnl1	UTSW	17	35982555	missense	probably benign	0.13
R5705:Gnl1	UTSW	17	35981600	missense	probably benign	0.01
R6372:Gnl1	UTSW	17	35982535	missense	probably damaging	1.00
R6520:Gnl1	UTSW	17	35982953	missense	probably benign	0.17
R6919:Gnl1	UTSW	17	35987533	nonsense	probably null
R7022:Gnl1	UTSW	17	35988728	missense	probably damaging	1.00
R7323:Gnl1	UTSW	17	35983413	missense	probably benign	0.01
R7693:Gnl1	UTSW	17	35988220	missense	probably damaging	0.97
R8232:Gnl1	UTSW	17	35987595	nonsense	probably null
R8320:Gnl1	UTSW	17	35982598	missense	probably damaging	1.00
R8840:Gnl1	UTSW	17	35982594	missense	probably damaging	0.98
R8883:Gnl1	UTSW	17	35982598	missense	probably damaging	1.00
R8899:Gnl1	UTSW	17	35988716	missense	probably damaging	1.00
R8946:Gnl1	UTSW	17	35983587	missense	probably benign	0.12
R9508:Gnl1	UTSW	17	35988733	missense	possibly damaging	0.92
X0027:Gnl1	UTSW	17	35987801	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TACTGATGTGCAAATGGGTGGC -3'
(R):5'- TCAGCCCAGAAGCAAAGCTG -3'

Sequencing Primer
(F):5'- AAATGGGTGGCTGTGGGGAC -3'
(R):5'- TTAGGCAGGACCCAGGATCTG -3'

Posted On

2019-10-17