Incidental Mutation 'R7537:Pcdhb11'
ID583683
Institutional Source Beutler Lab
Gene Symbol Pcdhb11
Ensembl Gene ENSMUSG00000051486
Gene Nameprotocadherin beta 11
SynonymsPcdhb5E, PcdhbK
MMRRC Submission
Accession Numbers

Genbank: NM_053136.3; Ensembl: ENSMUST00000053073

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7537 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37421418-37425836 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 37421619 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000056148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053073] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053073
AA Change: M1L

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056148
Gene: ENSMUSG00000051486
AA Change: M1L

DomainStartEndE-ValueType
CA 54 131 3.51e-1 SMART
CA 155 240 4.11e-21 SMART
CA 264 344 6.37e-27 SMART
CA 367 448 4.79e-22 SMART
CA 472 558 7.31e-27 SMART
CA 588 669 2.46e-10 SMART
Pfam:Cadherin_C_2 686 769 3.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.8367 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Insm2 T C 12: 55,599,518 S16P possibly damaging Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Pcdhb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Pcdhb11 APN 18 37421973 missense probably benign 0.00
IGL00906:Pcdhb11 APN 18 37422121 missense possibly damaging 0.67
IGL01610:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL01973:Pcdhb11 APN 18 37423512 missense probably damaging 1.00
IGL01977:Pcdhb11 APN 18 37422291 missense possibly damaging 0.49
IGL02164:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL02282:Pcdhb11 APN 18 37423828 missense probably damaging 1.00
IGL02674:Pcdhb11 APN 18 37423614 missense probably damaging 1.00
IGL02965:Pcdhb11 APN 18 37423968 missense probably benign
IGL03197:Pcdhb11 APN 18 37422424 nonsense probably null
1mM(1):Pcdhb11 UTSW 18 37423957 missense probably benign 0.00
R0001:Pcdhb11 UTSW 18 37423989 missense probably benign 0.06
R0383:Pcdhb11 UTSW 18 37423393 missense probably damaging 1.00
R0421:Pcdhb11 UTSW 18 37422480 missense probably benign 0.04
R0422:Pcdhb11 UTSW 18 37421870 missense probably damaging 1.00
R0427:Pcdhb11 UTSW 18 37422765 missense probably damaging 1.00
R0542:Pcdhb11 UTSW 18 37423834 missense probably damaging 1.00
R0620:Pcdhb11 UTSW 18 37421811 nonsense probably null
R1014:Pcdhb11 UTSW 18 37423369 missense probably damaging 1.00
R1277:Pcdhb11 UTSW 18 37421716 missense possibly damaging 0.79
R2034:Pcdhb11 UTSW 18 37422493 missense probably benign 0.00
R2142:Pcdhb11 UTSW 18 37422123 missense probably benign 0.28
R2496:Pcdhb11 UTSW 18 37422322 missense probably benign 0.30
R3077:Pcdhb11 UTSW 18 37422244 missense probably benign 0.08
R4560:Pcdhb11 UTSW 18 37423734 missense possibly damaging 0.61
R4590:Pcdhb11 UTSW 18 37422496 missense probably damaging 0.98
R4642:Pcdhb11 UTSW 18 37421968 missense probably benign 0.01
R4729:Pcdhb11 UTSW 18 37422366 nonsense probably null
R5012:Pcdhb11 UTSW 18 37422976 missense possibly damaging 0.48
R5364:Pcdhb11 UTSW 18 37422179 missense probably benign 0.06
R5910:Pcdhb11 UTSW 18 37423743 missense probably benign 0.43
R6023:Pcdhb11 UTSW 18 37422925 missense possibly damaging 0.94
R6106:Pcdhb11 UTSW 18 37423003 missense probably damaging 1.00
R6254:Pcdhb11 UTSW 18 37421718 missense probably damaging 0.99
R6276:Pcdhb11 UTSW 18 37421760 missense probably benign 0.36
R6360:Pcdhb11 UTSW 18 37422159 missense probably benign
R6699:Pcdhb11 UTSW 18 37422937 missense probably damaging 1.00
R6732:Pcdhb11 UTSW 18 37422144 missense probably benign
R6760:Pcdhb11 UTSW 18 37421584 intron probably benign
R6916:Pcdhb11 UTSW 18 37422381 missense possibly damaging 0.52
R7130:Pcdhb11 UTSW 18 37423506 missense probably benign 0.04
R7267:Pcdhb11 UTSW 18 37421953 missense possibly damaging 0.61
R7426:Pcdhb11 UTSW 18 37423260 missense probably damaging 0.99
R7444:Pcdhb11 UTSW 18 37422619 missense probably damaging 0.98
R7492:Pcdhb11 UTSW 18 37423444 missense probably damaging 1.00
R7504:Pcdhb11 UTSW 18 37421799 missense probably benign
R7728:Pcdhb11 UTSW 18 37423477 missense probably damaging 1.00
R7817:Pcdhb11 UTSW 18 37423909 missense probably damaging 1.00
R8071:Pcdhb11 UTSW 18 37422369 missense probably benign 0.02
R8229:Pcdhb11 UTSW 18 37422618 missense probably benign 0.00
R8254:Pcdhb11 UTSW 18 37422189 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AGAATGAGCTCTGCAGACACC -3'
(R):5'- CTAGTGGCCAGTTCTCCAAC -3'

Sequencing Primer
(F):5'- AGGAAGCCATCTCATTAAGTCG -3'
(R):5'- GCCAGTTCTCCAACCCTGAG -3'
Posted On2019-10-17